Subcloning and Characterization of C. Elegans Glyceraldehyde-3-Phosphate Dehydrogenase-3

PAGE 1

SUBCLONING AND CHARACTERIZATION OF C. ELEGANS GLYCERALDEHYDE 3 PHOSPHATE DEHYDROGENASE 3 By Justin Spengler A thesis Submitted to the Division of Natural Sciences New College of Florida In partial fulfillment of the requirements for the degree of Bachelor of Arts Under the sponsorship of Dr. Katherine Walstrom Sarasota, Florida May 2012

PAGE 2

ii Acknowledgements I would like to thank my mother and my family for all their dedication and support. New College, like most places, is a byproduct of the people who create it. To all my professors, and to those who help make New College the great place it is, I am forev er grateful. I know I have learned far more than I currently realize because of the high expectations you have set. This is especially true of my committee members, Dr. Walstrom, Dr. Scudder, and Dr. Clore. You all inspire me to be a better scholar and a better person; your teaching skills extend beyond the classroom. As important as professors are, an education without a personal component lacks significance. To all my friends who made this possible, thank you. I want to specifically thank Kaitlin, Kathl een, Evan, Estefan, Sa rah, Fermin, and Alex, for too many reasons to list. Your friendship helped to make the college experience what it should be a bombardment of new ideas and experiences that completely changes the way you think and live. You ha ve taught me more than I could ever have learned on my own. And most importantly, you all helped keep me sane when I knew I was losing it I know I could not have done this without you. d to this project. To Grace Bacon, M. Banks Greenberg, M. Leigh Cowart, Valeria Valbuena, and Megan Gautier thank you for putting in the effort to help make this project what it is. I would also like to thank the Council of Academic Affairs and the Student Research and Travel Grant, who both provided funding for this project.

PAGE 3

iii Table of Conte nts Acknowledgements ii Table of Contents iii List of Figures v List of Tables vii List of Abbreviations viii Abst ract x Chapter 1: Introduction 1 1.1: The importance of GAPDH 1 1.2: C. elegans as a model organism 1 1.3: The mechanism and active site of GAPDH 5 1.4: Glyceraldehyde 3 phosphate dehydrogenase 8 1.5: Previous work and kinetics 9 1.6: The IMPACT purification system 12 Chapter 2: Materials and Methods 15 2.1: gpd 3 primer design and preparation 15 2.2: PCR of gpd 3 18 2.3: pTYB11 plasmid preparation 21 2.4: Restriction digests and puri fication of cut gpd 3 and the plasmid pTYB11 23 2.5: Ligation transformation 27 2.6: Restriction digest with complete plasmid 28 2.7: Transformation into Rosetta cells 29 2.8: Test induction of GPD 3 29

PAGE 4

iv 2.9: Large scale induc tion 33 2.10: GPD 3 purification 34 2.11: Kinetics 37 Chapter 3: Results 38 3.1: Overview 38 3.2: Preparation of gpd 3 39 3.3: Preparation of pTYB11 47 3.4: Ligation transformation of gpd 3 and pTYB11 51 3.5: Full plasmid preparation 51 3.6: Test induction of Rosetta cells 54 3.7: Small scale purification of Rosetta cells 56 3.8: Large scale purification of Rosetta cells 58 3.9: Kinetics of GPD 3 61 Chapter 4: Discussion 64 4.1: Test induction of Rosetta cells 64 4.2: Small scale purification of Rosetta cells 65 4.3: Large scale purification of Rosetta cells 65 4.4: Kinetics of GPD 3 67 Chapter 5: Conclusions 69 References 7 1 Appendix A: Buffer recipes 76 Appendix B: Sequencing results 81 Appendix C: Kinetics results 84

PAGE 5

v List of Figures Introduction 1.1: Glycolysis 2 1.2: Life cycle of C. elegans 4 1.3: Equation of GAPDH 5 1.4: Mechanism of GAPDH 7 1.5: Structure of human GAPDH 9 1.6: IMPACT purification outline 14 Materials and Methods 2.1: Primer design and restriction sites 16 2.2: pTYB11 plasmid map 17 2.3: QIAgen miniprep procedu re outline 20 Results 3.1: Test PCR with 3 types of cDNA 41 3.2: Large scale PCR 42 3.3: Restriction digest map of gpd 3 and pTYB11 44 3.4: Restriction digest with PCR product 46 3.5: Restriction digest with pTYB11 48 3.6: Quantitation of pTYB11 purification 50 3.7: Ligation transformation products 54 3.8: Test induction stained with Coomassie 55 3.9: Test induction stained by Western blot 56 3.10: Small scale purification stained by Coomass ie 57 3.11: Small scale purification stained by Western blot 58

PAGE 6

vi 3.12: Large scale purification stained with Coomassie 59 3.13: Large scale purification stained by Western blot 60 3.14: Elutions of GPD 3 stained with Coomassie 61 3.15: Mich aelis Menten curve of G3P 62 3.16: Michaelis Menten curve of NAD + 63

PAGE 7

vii List of Tables Materials and Methods 2.1: Test PCR reagents 19 2.2: Restriction digest for pTYB11 reagents 24 2.3: Restriction digest for PCR product rea gents 24 2.4: Restriction digest of pTYB11 and PCR product for ligation reagents 25 2.5: Ligation transformation reagents 27 2.6: Restriction digest of complete plasmid reagents 28 Results 3.1: Primer DNA quantitation 40 3.2 : Purified PCR product DNA quantitation 43 3.3: Cut and purified gpd 3 DNA quantitation 47 3.4: Purified pTYB11 DNA quantitation 48 3.5: Cut and purified pTYB11 DNA quantitation 50 3.6: Ligation transformation colony growth 51 3.7: Complete plasmid purification DNA quantitation 53 Discussion 4.1: K m values of GAPDH from various organisms 68

PAGE 8

viii List of Abbreviations 1,3 BPG: 1,3 bisphosphoglycerate ATP: a denosine triphosphate bp: base pair BSA: b ovi ne s erum a lbumin CBB: Coomassie Brilliant Blue G 250 CBD: chitin b inding d omain DI: deionized water DTT: d ithiothreitol FT: flow t hrough G3P: glyceraldehyde 3 phosphate GAPDH: glyceraldehyde 3 phosphate dehydrogenase GPD: glyceraldehyde 3 phosphate dehydrogenase enzyme in C. elegans gpd : the gene glyceraldehyde 3 phosphate dehydrogenase in C. elegans GPD 3: glyceraldehyde 3 phosphate dehydrogenase enzyme #3 in C. elegans gpd 3 : glyceraldehyde 3 phosphate dehydrogenase gene #3 in C. elegans IMPACT: Intein m ediated p urification with an a ffinity c hitin binding t ag IPTG: i D 1 thiogalactopyranoside kDa: kilodalton LB: Luria b roth NAD + : nicotinamide adenine dinucleotide NADH: nicotinamide adenine dinucleotide, reduced NEB: New England Biolabs NP: nanopure wa ter

PAGE 9

ix OD: opti cal d ensity PEG: p olyethylene g lycol PVDF: p olyvinylidene f luoride QF: quick f lush SB Buffer: so dium b orate buffer SDS PAGE: sodium dodecyl sulfate polyacrylamide gel e lectrophoresis TBST: Tris b uffered s aline Tween 20 TE: Tris EDTA buffer

PAGE 10

x Abstract Glyceraldehyde 3 phosphate dehydrogenase (GPD) is an enzyme which converts glyceraldehyde 3 phosphate (G3P) into 1,3 bisphosphoglycerate using NAD + and P i as substrates. Due to the involvement of GAPDH in glycolysis, it can be found almost universally among organisms. C. elegans contains 4 GPD genes, and these proteins have not been characterized kinetically. GPD 3 was chosen for this study due to its in volvement in longevity in adult worms. The gpd 3 gene was inserted into the vector pTYB11, and the GPD 3 protein was overexpressed in E. coli cells. The GPD 3 purification was unsuccessful due to inefficient cleavage of the purification tag, so a prepara tion of endogenous GPD 2/GPD 3 was kinetically characterized. A K m of 0.3 mM and ~1 mM was obtained for NAD + and G3P, respectively. These K m values are significantly higher than in other species studied, and suggest the potential for further analysis. Dr. Katherine Walstrom Division of Natural Sciences

PAGE 11

1 Chapter 1: Introduction 1.1 : The importance of GAPDH GAPDH is a critical enzyme for both aerobic and anaerobic respiration, in nearly all organisms. The enzyme catalyzes the sixth step of glycolysis, which is an anaerobic process, leading to the formation of pyruvate (see Fig 1.1). The resulting pyruvate c an continue in an energy producing pathway through anaerobic fermentation or through aerobic respiration in the citric acid cycle. The 1,3 BPG created by GAPDH produces two ATP molecules when it is broken down by phosphoglycerate kinase and later by pyruv ate kinase The se two ATP molecules serve to refund the amount of ATP already invested in earlier steps in glycolysis, and further ATP production results in a net gain of ATP in the cell. Other pathways, including gluconeogenesis, photosynthesis, and the biosynthesis of both tryptophan and thiamine (vitamin B 1 ), also make use of the substrate G3P, so it is important to have GAPDH as an enzyme to produce and use appropriate amounts of the compound. Although humans cannot make tryptophan or thiamine, G3P i s an important substrate for those pathways in other organisms. 1.2: C. elegans as a model organism Caenorhabditis elegans is a widely used as a model organism in research. C. elegans is a species of nematode that grows to be about 1 mm in length, is transparent, and is naturally found in soil or rotting fruit Worms can be either male or

PAGE 12

2 hermaphrodite. Sydney Brenner was the first major researcher to study C. elegans which quickly gained use as a model organism thereafter (Brenner, 1974). A variety of reasons account for the widespread use of C. elegans as a model organism. Figure 1. 1 : A representation of the glycolysis cycle. Note the addition of the phosphate group from G3P to 1,3 BPG. http://en.wikipedia.org/wiki/Glycolysis I t is easy to grow in large quantities in terms of cost, storage, and time; it is transparent; it is a multicellular organism with a simple anatomy, yet many organs correspond to other animals The C. elegans genome was the first eukaryotic genome to be fully sequenced; and the sexes are easily distinguishable (Brenner 1974; The C. elegans Sequencing Consortium 1998). There are 4 genes that code for GAPDH in C. elegans : gpd 1 gpd 2 gpd 3 and gpd 4 GPD 2 and GPD 3 are isoenzymes, as are GPD 1 and GPD 4. Isoenzymes catalyze the same chemical reactions, but do not have the same amino acid sequence. GPD 1

PAGE 13

3 and GPD 4 are found primarily in non muscle cells of embryonic worms, and GPD 2 and GPD 3 are t ypically found and purified from body wall muscle cells in post embryonic worms (Yarbrough and Hecht, 1984). GPD 2 and GPD 3 were found to be in ten times abundance in post embryonic worms than in embryonic worms (Huang et al., 1989). mRNA taken from pos t embryonic larval worms show a large amount of gpd 2 / gpd 3 transcripts relative to gpd1 / gpd4 suggesting that both enzymes are expressed and active in these worms (Huang et al., 1989). The life cycle of C. elegans has distinct larval phases, separated by molts. Dauer worms are a special phase of C. elegans development during which the worm enters from the L1 phase when conditions are unfavorable. Scarcity of food, crowding, or unfavorable temperatures can cause the worm to enter the dauer phase, which can last 2 4 months. When the worm exits the dauer phase to continue development, no observable differences exist between a worm that was in the dauer phase and a worm that developed normally. Research o n the dauer worm is hoped to elucidat e a better understanding of the aging process and longevity (Riddle et al., 1997). Current research in C. elegans GAPDH has examined fat metabolism, regulation of hypoxia/anoxia, and expression in dauer worms. The daf 2 gene in C. elegans codes for a DA F 2 protein which acts as an insulin/IGF 1 receptor (Pierce et al., 2001) The DAF 2 protein is involved in the dauer pathway and also in anoxia response. GPD 2 and GPD 3 were found to be involved in regulating the anoxia response. RNAi pathways were us ed to reduce the amount of protein of various glycolytic enzymes, but anoxia

PAGE 14

4 survival rates were only reduced when GPD 2 and GPD 3 RNAi was used (Mendenhall et al., 2006) When GPD 2 and GPD 3 RNAi was introduced, worms were arrested during periods of ano xia, showing how sensitive worms are to anoxia when lacking GPD 2 and GPD 3. Wild type C. elegans can typically withstand anoxia for 1 day at any stage of development (Mendenhall et al., 2006). Literature is consistent on reporting that an upregulation o f GPD 3 (and usually GPD 2) are common in both dauer worms and in Figure 1.2 : The life cycle of C. elegans When conditions are unfavorable, the worms may enter the dauer stage of development and continue development as normal when proper conditions are met. http://www.wormatlas.org/ver1/handbook/anatomyintro/anatomyintro.htm daf 2 worms. (Scott et al., 2002; Ruzanov et al., 2007; Mendenhall et al., 2006; Ashrafi, 2007). McElwee et al. (2006) wrote that increased gluconeogenesis is observed in dauer worms and in daf 2 worms. This could be a way for organisms to convert unusable,

PAGE 15

5 stored energy from one cell into usable energy in other cells, to allow more energy for soma tic maintenance processes, and by extension, longer lifespans (McElwee et al., 2006). Despite current research into GAPDH functions in C. elegans and in other organisms, the kinetic information of C. elegans GAPDH is lacking. Goals of this project were to analyz e the kinetics of C. elegans GPD 3. Methods to purify the protein included first a vector system expression, then a n endogenous purification directly from C. elegans 1.3 : The m echanism and a ctive s ite of GAPDH The net reaction for GAPDH looks like this: Figure 1 .3 : The chemical equation of glyceraldehyde 3 phosphate dehydrogenase (Berg et al., 2007). The active site for catalysis is rather large, because it has to accommodate G3P, two phosphate groups, and the NAD + Residues ( numbered from the human ortho logs)

PAGE 16

6 Asp 35, Cys 152, His 179, Thr 182, Thr 211, Arg 234, Tyr 314, and Tyr 320 are considered to make up the active site of GAPDH (Butterfield et al., 2010; Jenkins and Tanner, 2006). These residues are actively involved in binding NAD + G3P, and in catalytic activity. Residue Arg 234 is believed to regulate G3P binding and release, is highly conserved, and when modified, has reduc ed GAPDH activity by 95% (Nagradova, 2001). The histidine residue acts as an activ ator for the cysteine residue and as a hydrogen donor (Soukri et al., 1989). The tyrosine residues in the enzyme help to bind the NAD + residues, and are susceptible to nitration. When cysteine residues were protected from nitration and the tyrosine resid ues were nitrated in an in vitro study, it was shown that the enzyme was unable to bind NAD + and the enzyme effectively lost all activit y (Palamalai and Miyagi, 2010). This mechanism is best characterized as a series of two addition eliminations to a carb onyl center (Figure 1.4 ). In th e first addition elimination, the histidine residue accepts the hydrogen from the cysteine, activating the cysteine for a nucleophilic attack (Yun et al., 2000). The c ysteine sulfur attacks the carbonyl carbon, creating a hemiacetal. A hydride ion is eliminated to convert NAD + to NADH which creates a thioester The NADH molecule moves out of the active site and is replaced by a NAD + molecule, which is thought to induce a positive charge on the thioester for the phosphate to attack it. The next addi tion is the inorganic phosphate to the carbonyl carbon, which then eliminates the sulfur regenerating the enzyme (Berg et al., 2007; Butterfield et al., 2010) The significance of having these two addition elimination reacti ons paired together becomes more apparent with the free energy of each

PAGE 17

7 Figure 1. 4 : The mechanism of GAPDH. A sulfur adds to the carbonyl, moving the electrons from the carbonyl double bond on to the oxygen which becomes negatively charged. The oxygen then moves a lone pair back down to reform the double bond and the hydrogen is pushed off as a hydride ion and added to NAD + converting it to NADH. A molecule of inorganic phosphate is then added to the carbonyl, which again moves the electron density o nto the oxygen, and back down eliminating the sulfur and taking back its hydrogen from the histidine residue. McMurry and Begley, 2005

PAGE 18

8 2007). By pairing the two reactions together, the reaction is close to equilibrium 1.4 : Glyceraldehyde 3 p hosphate dehydrogenase The approximately 37 kDa protein is found in many organisms across both eukaryotic and prokaryotic species, because it is so essential for aerobic respiration. Due to its roles in cellular metabolism, GAPDH is a common enzyme for use as a housekeeping gene by researchers (Barber et al., 2005; Eisenberg and Levanon, 2003). The structures involving catalysis, intersubunit contacts, and coenzyme binding are highly conserved across all species ; however, the sites surrounding the adenine and phosphate binding regions are not conserve d across species (Huang et al., 1989; Harris and Waters, 1976 ; K rawczyk et al., 1986 ; Butterfield et al., 2010 ). Different enzymes could therefore be expected to have different kinetics based on the binding of NAD + and phosphate. There are two domains for the protein: a N terminal NAD + binding domain and a C terminal catalytic domain (Nagradova, 2001; Butterfield et al., 2010). A Rossmann fold structure exists in the NAD + binding domain, where NAD + binds in an extended sheet that has a helix on both sides (Jenkins and Tanner, 2006). The catalytic domain of GAPDH consists twisted 8 sheets with three

PAGE 19

9 sheet of an ad jacent subunit on the other side (Cowan Jacob et al., 2003; Jenkins and Tanner, 2006; Butterfield et al., 2010). Figure 1 .5: Human form of GAPDH in ribbon form. In many organisms, as in humans, GAPDH exists as a homodimer in which all monomers are enzy matically active The structure is being viewed down the P axis, and NAD + molecules are drawn in CPK format (Jenkins and Tanner, 2006). 1.5 : Previous w ork and k inetics Although GAPDH research has been ongoing for more than 60 years, the research seems t o be generally segmented into two peak researching times: general kinetics and binding information in the 1970s, and non glycolytic cellular functions in the 1990s and 2000s. Papers on structure are found in both peaks. Apart from its role

PAGE 20

10 in metabolic p athways, current GAPDH research is heavily focused on these extra pathways, associations, and functions. The first large scale review of these functions was published by Sirover (1999), and is cited extensively in the literature. The Si r over article clai ms GAPDH involvement in: apoptosis, neuronal disorders, prostate cancer, DNA replication/repair, viral pathogenesis, and translational regulation, among others (Sirover, 1999). Later articles by Sirover claim further involvement in: nuclear membrane fusio n, maintenance of telomere structure, hyperglycemic stress, tumoregenesis, vesicular transport, diabetes, and a host of other activities (Sirover, 2005; Sirover, 2011). All of the Sirover articles focus on mammalian GAPDH enzymes. Some of these involvements will be discussed here, but addressing the whole range of these topics is beyond the scope of this project. Research into GAPDH substrate binding is somewhat at odds with itself. Many papers were published documenting the extent of and rationale for negative cooperativity of coenzymes in GAPDH, and some opposing theories were put forth about its binding sites Researchers discovered increasing NAD + saturation decreased its binding affinity i n rabbit skeletal muscle (Velick et al., 1953). Some believed this was caused by a half of the sites reactivity, but it was shown that a conformational change occurred when the oligomer reached h alf saturation by NAD + in yeast and rabbit muscle (Stallcup and Koshland, 1973 a; Stallcup and Koshland, 1973b; Levitski, 1974; Bell and Dalziel; 1975). This conformation shift was originally attributed to the adenine subsite, but later research on rabbit muscle GAPDH discovered that the nicotinamid e moiety is actu ally the controlling factor for conformational shifts (Henis and Levitzki, 1977; Henis

PAGE 21

11 and Levitzki, 1980). The nicotinamide binding affects the adenine subsite, which then causes a conformational change in the other adenine sites of attached subunits (He nis and Levitzki, 1980; Gafni, 1979). The precise conformational changes in the active sites are still not known, but research on this topic is ongoing (Nagradova, 2001). One research team discovered there is no negative cooperativity binding at pH 9.4 i n rabbit muscle GAPDH but this research is less useful in organisms that cannot attain a pH of 9.4 in the majority of their cells (Reynolds and Dalziel 1979). Since the research being presented here is more focused on general biological systems, this inf ormation is largely for theoretical purposes and presented for completeness. All four subunits of GAPDH are active and will complete both forward and reverse mechanisms (Harris and Waters, 1976). In yeast GAPDH will catalyze reactions as a monomer, dimer trimer, or tetramer, with nearly equal V max values (Ashmarina et al., 1982). However, in the presence of non saturating concentrations of coenzymes, the kinetics show dissimilarity in their V max values (Ashmarina et al., 1982). The kinetics examined in this paper have not been studied with enough detail to comment on subunit cooperativity or oligomeric state. M any of the more recent articles on GAPDH focus on its interaction with cellular oxidative stress. When a cell is under oxidative stress, there are many pathways to relieve the stress, including tyrosine nitration and cysteine modification. In rabbit S. aureus and human GAPDH, t he cysteine residue found in the active site is susceptible to S thiolation an d being oxidized by nitrating agents (Palamalai and Miyagi, 2009; Weber

PAGE 22

12 et al., 2004; Nakajima et al., 2009). During respiratory burst, which releases oxidating agents into nearby cells, or addition of H 2 O 2 to the extracellular fluid, GAPDH function was f ound to be inactivated. Upon addition of d ithioerythritol ( DTE ) to free the bound thiols, human GAPDH activity was restored. It was suggested that GAPDH is part of a cellular pathway to absorb some oxidative damage to prevent the rest of the cell from be ing damaged, but this theory has not been directly researched (Ravichandran et al., 1994; Schuppe Koistinen et al., 1994). Subsequent research in Saccharomyces cerevisiae showed that the levels of H 2 O 2 being used in those studies were much higher than lethal doses, suggesting that the cell had other mechanisms to alleviate oxidative stress at biologically relevant concentrations (Cyrne et al., 2010). 1.6: The IMPACT purification system This project was designed to use the IMPACT system (NEB N6901) to express GPD 3 in E. coli cells. g pd 3 was inserted into the cloning vector pTYB11 overexpressed in E. coli and purified. IMPACT stands for Intein Mediated Purification with an Affinity Chitin bindi ng Tag which loosely describes the process. The protein of interest, in this case GPD 3, wa s produced as one long fusion protein with an intein tag at the nitrogen end. Intein is a general term applied to a self splicing region of protein. In the case of this system, the intein used is from the Saccharomyces cerevisiae VMA1 gene and is approximately 56 kDa. It is attached to a chitin binding domain that binds chitin and the intein is cleaved with DTT (a thiol reagent) eluting GPD 3 from the chitin column

PAGE 23

13 (NEB, 2007). There are cloning vectors that attach an intein to the C terminus of the target protein but the N terminus was selected in this case as a first attempt because both the C terminus and the N term inus were relatively free of any obstruction based on crystal structures of orthologous proteins Figure 1.6 outlines the overall process of purification with the IMPACT system, most notably that the intein tag sh ould be produced on GPD 3 as a fusion prot ein, and c ould later be cleaved to elute only the protein (Chong et al., 1998) The IMPACT vector comes with genes encoding for ampicillin resistance so that the bacteria can be grown on ampicillin containing plates and selected for based only on their presence. Of course, not every colony that grows in the presence of AMP will have the plasmid, but a high percentage of the surviving colonies will. After the plasmid is transformed into cells, the cells will overexpress a fusion protein of GPD 3 + an i n tein tag, as seen in figure 1.6 The target protein will be loaded onto a chitin containing column, where the intein will bind, cleave from the GPD 3 in the presence of DTT, and the GPD 3 will be eluted and collected from the column.

PAGE 24

14 Figure 1. 6 : A diagr am showing the process of purification for GPD 3 from the IMPACT kit. First the target gene is ligated into the vector, then the vector is inserted into E. coli and expressed. The expressed protein has an intein tag, which binds to chitin in a chitin col umn. The protein is attached to a chitin column, and eluted off independently through cleavage of the intein and protein residues. Image modified from: IMPACT kit Instruction Manual, New England Biolabs, Version 2.1 July 2007.

PAGE 25

15 Chapter 2: Materials and methods Note: All buffer recipes can be found in the appendix. 2.1: gpd 3 p rimer design and preparation Primers targeting the gpd 3 gene in C. elegans were prepared using the sequence of gpd 3 from www.wormbase.org Each primer (forward and reverse) was designed to anneal to the gene and to also add a restriction site at the ends of the gene (see figure 2.1) These restriction sites were chosen so that the gene could be ligated into the vector pTYB11 and be connec ted to the intein tag Each primer was diluted to 300 M upon arrival with 5 mM Tris, pH 8.0 The primers were run on a 10% urea acrylamide gel and purified to prevent any degraded primer pieces from introducing mutations in the final plasmid. Fifty L of each primer was combined with 50 L of 2X urea LB and loaded into a 2 lane gel. The gel was run at 200 V The resulting gel was set over a fluorescent TLC plate to image the gel with UV light and the appropriate primer bands were cut out of the gel It is important to only cut out the minimum amount of gel that contains the most amount of the desired DNA, to avoid having a purification that leads to dilute samples. The gel pieces were put into 1.5 mL tubes, crushed, and washed with gel elution buf fer. These tubes were wrapped with parafilm and incubated at 37 C with shaking o vernight to elute the primers from the gel Agarose gels work on the principle of using an electric field to move samples down a gel. Nucleic acids, which have negatively ch arged phosphate groups, are moved towards the positive end of the gel box. Smaller fragments are able to pass more freely

PAGE 26

16 through the agarose matrix, causing smaller sizes to travel longe r distances down the gel. Figure 2.1: Visual representation of h ow the primers for gpd 3 were created. The XhoI cleaving site is GAGCTC. The SapI cleaving site is GAAGAGC. A: The beginning of the forward and reverse strands of the cDNA for gpd 3 is shown. The only part of the primer that does not bind with the DNA introduces a cleavage site, which was replicated into new strands through PCR. B: The multiple cloning sites for pTBY11 are shown. Note that the SapI site is directly next to the intein tag. C: The full sequence of the gpd 3 primers. Ap proximately 150 L of liquid from each tube was transferred to a new tube. The original tubes were washed with 200 L of gel elution buffer to collect any remaining primer. A phenol chloroform extraction was performed with 300 L phenol

PAGE 27

17 per tube. The proteins in the sa mple are denatured, and appear at an interphase between the lower organic phase and the upper aqueous phase while the nucleic acids move in to the aqueous phase. The tubes were vortexed to ensure thorough mixing then centrifuged at 15,000 rpm for 1.5 minut es. The top aqueous layer was transferr ed to a new tube, and care was taken to remove only the top layer as the bottom layer includes contaminating agents. A volume of 100 L gel elution buffer was added to the phen ol tube, and centrifuged again. The to p layer of this solution was combined with the previous aqueous layer Figure 2.2 : The vector pTYB 11 from NEB. The whole plasmid DNA is shown. Arrows inside the circle are coding regions, and the restriction sites are shown on the outside of the circle. Figure from NEB.

PAGE 28

18 The tubes containing the DNA were centrifuged at 15,000 rpm for 2 minutes, and all liquid ( but no gel pieces ) was transferred to a new tube. One L of glycogen (20 g) was added followed by 2.5X volume of 100% EtOH, and they we re centrifuged on high speed for 20 minutes at 4 C. Glycogen acts as a DNA carrier, and helps to increase DNA yields in low quantity samples, without affecting the sample purity. Ethanol reacts with nucleic acids to precipitate them. Nucleic acids are high dielectric constant, which shield s the charge from phosphate groups in DNA. are not s hielded and the phosphate groups from nucl eic acids can form ionic bonds with positive ions and precipitate. V ery small pellets were visible after spinning The EtOH was carefully removed and 200 L 75% EtOH was added to all tubes. The tubes were centrifuged again on high for 5 minutes in 4 C. All liquid was carefully removed, and the tubes were air dried for 10 minutes. Each pellet was resuspended in 15 L 5 mM Tris pH 8 and the absorbance s at 230, 260, and 280 nm were measured with a n OLIS upgraded CARY 14 UV V IS spectrophotometer to determine the concentration of the samples. Stocks of 10 M were made and stored at 20 C. The concentration of DNA present was quantitated from these values. 2.2: PCR of gpd 3 The primers were used in a PCR to amplify the C. ele gans cDNA. Dr. Walstrom provided the cDNA, purified from worms grown in 22 C or 15 C These cDNA samples

PAGE 29

19 had been prepared by a previous thesis student for a different project By using three cDNA samples, the odds of at least one sample working incre ased. A PCR amplified the target DNA, in this case gpd 3 See table 2.1 for a list of ingredients in the PCR mixture. PCR works by a series of heating and cooling steps and the amount of DNA doubles per cycle. The mixture includes dNTPs, which allow for DNA polymerization primers to anneal to the DNA strands, and a DNA polymerase to perform the replication. First, the solution is heated to separate the DNA strands by breaking the hydrogen bonds that hold the nucleotides together. The n the temperatu re is lowered and complementary DNA strands anneal back together. Primers bind to the DNA during this step. The reaction is heated again to a temperature at which the DNA polymerase starts the replication process, and the DNA is extended using the dNTPs in solution. Repeating this cycle allows for a large amount of DNA to be made from a very small sample. The program for the PCR was: 95 C for 2 minutes, 95 C for 30 s, 55 C for 30 s, 72 C for 2 minutes, repeat this procedure for 35 cycles (from the 95 C at 30 seconds), then hold at 72 C for 10 minutes, and stabilize the DNA at 4 C Reagent L in PCR cDNA 1 Forward primer (10 M) 1 Reverse primer (10 M) 1 dNTPs (1 mM) 12.5 Pfu Buffer (Stratagene, 10X) 5 Pfu Hotstart Turbo ( Stratagene, 2.5 U/ L) 1 NP 28.5 Table 2 .1: Initial PCR reaction testing cDNA. Three different cDNAs were used: purified from worms grown in 22 C or 15 C

PAGE 30

20 PCR was tested on a 1% agarose gel with Gel Red to detect samples To load, 5 L Orange G loading dye mixed with 5 L sample were pipetted into the lanes The gel was run at 110 V. Figure 2 3 : An overview of the procedure used to purify PCR product. This figure was modified from QIA Miniprep Handbook, Second Edition, December 2006. QIA GEN, all rights reserved. The PCR product was cleaned using the QIAgen Miniprep kit See figure 2. 3 for an overview of the cleaning process. In order to prevent discarding a significant amount of DNA that may not elute on the first elution with TE, each column wa s eluted twice. A total of 165 L of the PCR product was purified and eluted with 20 L NanoPure water ( NP ) Most of the DNA was recovered in the first elution.

PAGE 31

21 2.3: pTYB11 plasmid preparation From a stock solution of pTYB11 stored at 20 C a nd 0.2 mg/mL, a 1:1 dilution was made with nanopure water. Chemically competent Top 10 cells (100 L, produced by Invitrogen ) stored at 80 C were thawed on ice A volume of 1 L 0.1 mg/mL pTYB11 was mixed with the chemically competent cells and incubat ed on ice for 30 minutes. The cells were immersed in a 37 C water bath for 1 minute, incubated on ice for 2 minutes, combined with 1 mL room temperature LB, and incubated at 37 C for 1 hour with shaking. This heat shock procedure allowed the plasmid to enter the cell membrane and be taken up by the cell. The cells were then plated in LB+AMP plates (1:1000 dilution of 100 mg/mL ampicillin) and incubated at 37 C overnight. The next day, the plates were re moved from 37 C and stored at 4 C. Two individual colonies were each placed in vials containing 5 mL of LB with 5 L AMP (100 mg/mL) and incubated at 37 C for 1 hour with shaking. One vial was added to a solution of 195 mL LB+AMP and incubated at 37 C overnight with shaking, and the other tube was stored at 4 C as a backup The cells were removed from incubation the next morning. They were light brown and turbid indicating that the cells had grown well The cells were centrifuged at 5,000 rcf for 5 minutes. The supernatant was discarded, and the pellets were stored in 20 C. The pellets contained the cells with plasmid in them. T he pellets were each resuspended in 250 L GTE. GTE, or glucose Tris EDTA ( Ethylenediaminetetraacetic acid ) solution is used to protect the DNA as it is being

PAGE 32

22 extracted. The glucose helps keep the solution isotonic, the Tris provides a pH buffer, and the EDTA chelates any free metals in solution to keep them from catalyzing chemical or enzymatic reactions The following steps were conducted quickly on ice. L ysis buffer ( 375 L ) was added to each tube, vortexed, and incubated on ice for 5 minutes. The lysis buffer contains NaOH, which lyses the cell and melts the DNA, and sodium dodecyl sulfate ( SDS ) which reacts with the lipid membrane and cellular proteins. Each tube then received 250 L 3M potassium acetate ( KOAc ) pH 5.3, was vortexed, and incubated on ice for 10 minutes. KOAc renatures plasmid DNA and precipitates SDS bound molecules. All tubes were centrifuged at 13,000 rpm for 10 minutes in 0 C. This centrifugation step allows the majority of cellular debris to collect in the pellet, while leaving nucleic acids in the supernatant. All supernatant was transferred to a new tube and had 2 L RNase A added to degrade RNA The tubes were incubated at 37 C with shaking for 30 minutes. T hen one volume of isopropanol was added to each tube to precipitate the nucleic acids A 30 minute incubation on ice was followed by 10 minutes of spinning on high t o precipitate the nucleic acids The supernatant was discarded. A 200 L wash with 70% EtOH was centrifuged for 5 minutes, and again the supernatant was discarded This ethanol wash is a final cleaning step which helps remove any remaining SDS. Each pellet was resuspended in either 50 L or 100 L TE, but combined in such a way to produce 2 tubes of 250 L total. A 1:1 ratio of phenol was added to each tube, vortexed, then centrifuged on high for 2.5 minutes. The top layer was transferred to a new tube and stored. Next, 50 L of 3 M NaOAc pH 5.2 was added to each tube, followed by 1 mL of 100% EtOH. A 15

PAGE 33

23 minute incubation on ice was followed by a 15 minute spin on high. The supernatant was discarded and another 200 L 100% EtOH was added and centrifuged for 2.5 minutes. The EtOH was removed, and the tubes were exposed to air dry. TE ( 250 L ) was used to resuspend each pellet, and the pellets were combined into a single tube of 500 L. A volume of 120 L 5 M NaCl and 300 L 20% PEG 8,000 wa s added to the DNA, which was stored in 0 C overnight. The polyethylene glycol (PEG) helps to compress the plasmid DNA into small globular shapes rather than having them as coils, which allows only the DNA (not the digested RNA fragments) to b e precipita ted by centrifugation The DNA was centrifuged on high in 0 C for 10 minutes. A wash with 150 L 70% EtOH was performed and centrifuged for 2.5 minutes and the tube air dried. Twenty L NP water was added to the tube and a pipet tip was used to scrape the sides of the tube to collect the DNA into the water. The spectrophotometer was used to quantify the amount of DNA present. 2.4: Restriction digests and purification of cut gpd 3 and the plasmid pTYB11 Once the gene and the vector had been isolated, a r estriction digest was performed and the products analyz ed by running the products on an agarose gel. A restriction digest is a procedure which combines restriction enzymes with DNA; the DNA is cut at any site that matches cleavage recognition sites for the restriction enzymes. This experiment tested the PCR products and plasmids to see if the observed DNA masses were at the expected values for the gpd 3 gene alone or for the pTYB11 plasmid

PAGE 34

24 To construct the desired expression plasmid the gp d 3 PCR product and the vector were cut with XhoI and SapI and the appropriate pieces of DNA were purified in preparation for the ligation. A 75 minute digestion at 37 C was then run on a 0.8 % agarose gel for the plas mid and a 1 % agarose gel for the PCR product. Table 2.3 shows the restriction digest of the PCR product had a 1:1 ratio of restriction enzyme to PCR product, but there should be at least a 5:1 ratio to ensure the majority of the DNA does get cut, which was included in all later reactions. Reagent Uncut SapI XhoI SapI+XhoI NEB Buffer 4 (10X) 2 2 2 2 BSA (10X) 2 2 2 2 Plasmid (0.25 g) 1 1 1 1 SapI ( NEB, 2 U/ L) 0 1.25 0 1.25 XhoI ( NEB, 2 U/ L) 0 0 1.25 1.25 NP 15 13.75 13.75 12.5 Table 2.2 : R estriction digest for pTYB11 plasmid. Each column includes the amount of reagents ( L) in each reaction. All reactions had 20 L total, and were run at 37 C for 75 minutes. Restriction enzymes were purchased from NEB. Products were run on a 0.8 % agarose gel. Reagent Uncut EcoR I Sac I Sa c I+ Ec o R I NEB Buffer 4 (10X) 2 2 2 2 BSA (10X) 2 2 2 2 PCR product (46.2 g/mL) 3 3 3 3 SacI (NEB, 0.1356 U/ L) 0 0 1 1 EcoRI (NEB, 0.1356 U/ L) 0 1 0 1 NP 13 12 12 11 Table 2.3: R estriction digest for PCR product. Each column indicates amount of reagents ( L) in each reaction. All reactions had 20 L total and were run at 37 C for 75 minutes Restriction enzymes were purchased from NEB. Products were run on a 1% agarose gel.

PAGE 35

25 Reagent Uncut Plasmid PCR product NEB Buffer 4 (10X) 6 6 6 BSA (10X) 6 6 6 PCR product (46.2 g/mL) 0 0 37 Plasmid (3.173 g) 0.7 0.7 0 XhoI (20 U/ L) 0 1 1 SapI (2 U/ L) 0 5 5 NP 47.3 41.3 5 Table 2 .4 : R estriction digest for PCR product and plasmid in preparation to ligate the two Each column indicates amount of reagents ( L) in each reaction. All reactions had 6 0 L total and were run at 37 C for 70 minutes Restriction enzymes were purchased from NEB The QIAgen PCR clean up kit was used to purify the gpd 3 PCR product and the spectrophotometer was used to quantify the concentration of purified DNA, using the same procedures described earlier The plasmid wa s purified on the third attempt of using a crystal violet gel purification kit (S.N.A.P. UV Free Gel Purificatio n Kit, Invitrogen) Crystal violet gels offer a way to increase cloning efficiency through a gel purification method which stains the DNA in the visible light spectrum. Ethidium bromide staining of gels reduces the cloning efficiency and requires the DNA to be exposed to UV light, which can damage the DNA. The third time this gel was run the restriction d igest time was extended to 75 minutes to ensure more efficient restriction enzyme cleavage Two lanes from the 12 lane gel comb were combined with tap e to make large lanes for the samples to run on. Larger lanes were tried in previous attempts but the resulting bands were too wide, causing too much dilution of the DNA samples. Twelve L crystal violet load ing dye (6X) was added to each digest (cut and

PAGE 36

26 uncut plasmids), and the gel was run at 110 V until ~ 1 / 3 of the crystal violet moved up the gel. The plasmid b and was cut and massed and a conversion of 1 mg = 1 L yielded a volume estimate for the sample A 2.5 X volume of NaI solution (6.6 M sodium iodide, 16 mM sodium sulfite) wa s added and the solution was heated at 45 C until the agarose dissolved. A 1.5X volume of binding buffer (7 M Guanidine HCl) was added, followe d by addition to the column and th en a spin of the column at 5,200 RPM for 30 s econds The flow through wa s loaded twice more onto the column and centrifuged This wa s followed by two spins with 400 L 1X Final Wash solution at 5,200 RPM for 30 seconds. The flowthrough was discarded, an d a one minute spin at 13,000 RPM was performed. The filter was eluted twice with 30 L NP. These procedures can also be found in the SNAP UV Free Gel Purification Kit instructions (Invitrogen, 2000). After the crystal violet purification of the cut pTYB11, there was contamination that prevented the spectrophotometer from reading the concentration of DNA properly. To test if DNA wa s present in the samples a 0.8% agarose gel was loaded with 100, 200, a nd 300 g samples of uncut plasmid and the product samples from two separate gel purifications Except for the known concentrations of the uncut plasmid, 5 L of all reagents were loaded with 1 L Orange G dye and the gel was run at 110 V

PAGE 37

27 2.5: Liga tion t ransformation The purified plasmid and gene were ligated together. Two reactions w ere completed : one with the PCR insert and one without it as a negative control. The solutions were held at 20 C for 30 minutes, and then at 65 C for 10 minutes. Reagent + I nsert I nsert Plasmid (40 ng) 4 4 PCR insert (42.9 g/mL) 1.5 0 T4 DNA Ligation Buffer (NEB 400,000 U/mL) 1 1 T4 DNA Ligase ( NEB, 10X) 1 1 NP 2.5 4 Table 2.5: The l igation transformation of the PCR product and the plasmid. The sample without the PCR insert is acting as a negative control. The ligation was conducted at 20 C for 30 minutes, followed by 65 C for 10 minutes. A tube of electrocompetent Top10 cells (Invitrogen) were then thawed on ice. An electroporation was completed with a 1 mm cuvette L ligation product in 50 L cells. One mL cold super optimal broth with catabolite suppression ( SOC ) was added immediately after elec troporation and the cells were incubated at 37 C for 1 hour with shaking. The cells were plated and grown at 37 C overnight. The next day, 4 colonies were each selected, transferred to 50 mL LB Broth inoculated with 50 L ampicillin (100 mg/mL), and grown overnight with shaking at 37 C. Only colonies from the ligation containing the gpd 3 insert were selected The cells were centrifuged in 50 mL centrifuge tubes for 5 minutes at 5,000 RCF. Each sample was purified separately. The plasmids were all purified with the same

PAGE 38

28 procedure described above in section 2.3, starting with the GTE solution, and ending with quantitation of the DNA by the spectrophotometer. Four plasmid candidates were stored in 20 C. 2.6: Restriction digest with complete p lasmid To be sure the ligation occurred as expected, two of the DNA samples from the plasmid (# 2 and # 3) were compared to the original uncut plasmid to test for gpd 3 insert ion There was a negative control of no plasmid. The samples were loaded in the restricti on digest Reagent No plasmid Uncut Product 2 Product 3 NEB Buffer 4 (10X) 2 2 2 2 BSA (10X) 2 2 2 2 Plasmid original (1 g/ L) 0 1 0 0 Plasmid 2 ( 101.75 g/mL) 0 0 1 0 Plasmid 3 ( 67.1 g/mL) 0 0 0 1.5 SapI (1 U/ L) 1 0 1 1 XhoI (2 U/ L) 1 0 1 1 NcoI (NEB, 2 U/ L) 1 0 1 1 NP 13 15 12 11.5 Table 2 .6 : Restriction digest of the complete plasmid pTYB11 with the gpd 3 insert. The samples without plasmid and uncut plasmid acted as a negative control. The digest was conducted at 37 C for 90 minutes and the products were run on a 0.8 % agarose gel. at 37 C for 90 minutes. A 0.8% agarose gel was run with 10 L of the products with 2 L Orange G dye at 110 V. The complete plasmid was also sequenced to confirm the

PAGE 39

29 correct gene was ligated into the plasmid, and that no mutations (especially frameshift mutations) were present. 2.7: Transformation into Rosetta Cells Novagen Rosetta (DE3) Competent Cells were used for the expression of protein because they contain tRNAs for codons not normally expressed in E. coli cells. This makes the expression of eukaryotic proteins more compatible in the prokaryote (Baca and Hol, 2000) Twenty L cells w ere combined with 5 ng of plasmid. P lasmid was added to 20 L cells and was in cubated on ice for 5 minutes. Then, an i ncubat ion at 42 C for 30 seconds in a water bath was performed followed by incubation on ice for 2 minutes. Eighty L room temperature SOC was added and the cells were incubate d at 37 C for 1 hour with shaking. T he cells were plated on LB+AMP plates and stored overnight at 37 C. The next day, 2 X 10 mL starter cultures were prepared in TB with 10 L ampicillin (100 mg/mL). T he cultures were incubated at 37C overnight. 2.8: Test induction of GPD 3 Starter co lonies were diluted 1/100 in TB, with a 1:1000 dilution of ampicillin (100 mg/mL). The cultures were all grown at 37 C until the OD 600 was above 0.5. At this point, some cells were taken and turned into the uninduced samples. C ell growth s were placed a t either 37 C with shaking or at room temperature with shaking. All induced samples were then induced with 0.4 mM IPTG. Two 1 mL samples were taken

PAGE 40

30 from each 37 C growth at 2, 4, and 6 hours. Samples from the room temperature cultures were taken at 12, 16, and 20 hours. Uninduced samples were also taken at each time point. The samples were centrifuged for 5 minutes at 13,000 RPM the supernatant was removed, and the pellets were frozen. A SDS PAGE was run on the induction samples in duplicate, so t hat one could be developed by Coomassie Blue staining and the other by Western. Poly acrylamide gel electrophoresis, commonly known as PAGE, is a separation technique used to separate proteins based on their size and charge. The proteins are first denatur ed by SDS. T hen they are placed in an acrylamide gel in an electric field The samples run toward the positive pole and the approximate size of the protein can be compared to a standardized protein l adder, which is also run on the gel. The acrylamide c reates a matrix of open spaces and a web like structure the proteins need to pass through, so smaller proteins are more able to navigate the gel and therefore travel farther distances than larger proteins. In an SDS gel, the proteins are all covered with SDS, which has a negative charge, and runs the samples towards the positive end. This method works under the assumption that each protein is charged the same amount proportionate to its mass, which is not always the case. Typically, though, the differenc es in charge of proteins create only a small inconsistency in proteins, and the bands can be taken as accurate. The running gel was 10% acrylamide, and the stacking gel was 5% acrylamide. All pellets were resuspended in 5 0 L 1 X SDS Load Buffer, wh ile 40 L of liquid samples

PAGE 41

31 were combined with 20 L 3X SDS Loading Buffer All samples were boiled for 5 minutes at 100 C. Fifteen L of each sample was loaded with 5 L ladder The gels were run at 200 V, 70 mA. After the SDS PAGE procedure, each gel was stained with a different procedure The gel to be stained by Coomassi e Blue was washed three times in distilled water and then put in a solution of Coomassie Blue stain and microwav ed for 1 minute. The gel was removed and incubated for one hour with shaking, followed by a destaining period until the bands were easily visible. The second gel was used for a Western blot. To start the Western procedure, the stacking gel was removed. Two pieces of 3 MM filter pape r and a polyvinylidene fluoride (PVDF) membrane (purchased from Millipore) were cut out to the same size as the gel. To activate the membrane, it wa s first washed for 15 seconds in 100% methanol, followed by a wash of NP for 2 minutes. PVDF membranes are sturdy, chemically resistant, and bind strongly to proteins, making it an ideal membrane for Western blotting. The membrane and filter paper were allowed to equilibrate with the Western transfer buffer for 5 minutes, before being combined with the gel. The membrane was overlayed on the gel, and the filter paper was applied to each side. Air bubbles were removed carefully by pushing a horizontal glass rod across the surface of the filter paper, so as not to directly contact the membrane. It is important to remove all air bubbles so that all proteins get transferred cassette, which was closed with sponges on either side. The cassette wa s returned to

PAGE 42

32 the Western tank and filled with transfer buffer. Care was taken to insure the membrane was facing the positive (red) electrode so that the proteins would move toward the membrane The proteins move from the negative side where the gel faces towards the positive side for the same reason they move towards the positive end in the SDS PAGE: the proteins are negatively charged due to the SDS. The Western tank was run at 200 V, 90 mA overnight with stirring. To visualize the proteins the membrane wa s remov ed from the gel box and put into a 3% nonfat dry milk solution with TBST. All inc ubation steps for the Western wer e done with shaking. The 3% block was completed in 90 mi nutes. Milk is used to block the membrane by providing a variety of proteins that w ill attach to the membrane where no other proteins are already attached. By keeping the membrane saturated with protein, it is difficult for antibodies to bind to the membrane, and therefore the antibodies should only bind to their specific targets. Two washes with TBST were performed for 10 minutes each, and the primary antibody solution was then added. The primary antibody solution wa s 0.5% milk with a 1:5,000 dilution of the Anti chitin binding domain antibody (3 L in 15 mL solution). This solution was the only one which wa s kept for multiple uses, and wa s stored at 4 C when not in use. The primary antibody wa s incubated for 1 hour, and then two more washes with TBST we re performed. The primary antibody binds to the c hitin binding domain, next to the intein tag of the fusion protein. The secondary antibody was then introduced : 4 L a nti rabbit AP conjugate antibody was mixed in 15 mL of TBST plus 0.5% milk This solution was incubated with the membrane for 1 hour, fo llowed by 3 X 10 mL washes with TBST. The

PAGE 43

33 secondary antibody binds to the primary antibody. The Western was developed by an alkaline phosphate (AP) development buffer. The final ingredients were 132 L 50 mg/mL nitro blue tetrazolium (NBT) and 66 L 50 mg/mL 5 bromo 4 chloro 3' indolyphosphate (B CIP), added just before the buffer was applied to the membrane The dyes in this solution react colorimetrically to stain the membrane. BCIP reacts with alkaline phosphatase and dimerizes to form a dye. When t he BCIP dimerizes, the NBT is reduced. This dye binds to the proteins and antibodies on the gel. The development solution was decanted the membrane was rinsed with nanopure water, and then the membrane was dried and stored. 2.9: Large scale induction: Another transformation of plasmid into Rosetta cells was completed, as described above. The cells were incubated for 1 hour with shaking at 37 C, and then plated and grown overnight at 37 C. Three starter cultures of 7 mL each were incubated overnight with shaking. The next day, 2 X 500 mL cultures were started with 500 L ampicillin (100 mg/mL) and 5 mL from the starter cultures. Two other 50 mL cultures were started with 50 L ampicillin (100 mg/mL) and 0.5 mL starter culture. These were all grown to log phase in 37 C. Both 500 mL growths were induced at 0.4 mM IPTG and grown in 37 C. The 50 mL cultures were used as an uninduced control. Samples were taken at 0, 2, and 4 hours, with the 4 hour spin being collected in 50 mL

PAGE 44

34 centrifuge tubes and centrifuged at 5,000 RCF for 5 minutes. The pellets were stored in 20 C. 2.10: GPD 3 p urification Five mL of chitin beads were added to the purification column. The column was washed with 10X column buffer. A small purification was performed first t o optimize it so that the large scale purification would be more effective. Each pellet was thawed on ice and resuspended in 5 mL each of lysis buffer. All resuspended pellets were combined into 1 tube. Two 1 mL samples were taken from the crude pellets centrifuged and stored as a cell pellet sample An ultrasonicator on power level 10 was used to lyse the cells for 5 minutes with the power on for 15 seconds alternating with 15 seconds off. The ultrasonicator breaks open cell membranes and fragments the DNA usin g ultrasound frequencies. Two 1 mL s amples of crude lysate were centrifuged to store. The large solution was centrifuged at 9600 RPM for 30 minutes and the supernatant was transferred to a new tube The pellet was resuspended in lysis buffer and re sonicated, but the result was a white foam that did not appear to have much cell lysate so was discarded. The clarified lysate was loaded on the column at 1 mL/minute. The flowthrough was collected, and a 1 mL sample was taken. Th e flowthrough should contain most of the clarified lysate solution except the fusion protein, which should bind to the column. A 50 mL solution of column buffer was loaded over the column, labeled at the beginning of the wash Five mL of

PAGE 45

35 cleavage buffer was added and allowed to run through the column. This was collected flow was stopped. The apparatus was sealed with parafilm and left overnight. Six 1 mL elutions were collected the next day. The column was left overnight so that the DTT could react with the intein and induc e cleavage. Dialysis tubes were made by cutting approximately 15 cm of Snakeskin Dialysis T ubing ( 3.5 kD a mo lecular weight cut off, Pierce) and soaking in dialysis buffer for 5 minutes. The tubing was then clamped at one end, the elution was pipetted in, and the other side was folded over and clamped. The tubes were left in dialysis buffer in 4 C for 4 hours with stirring, and then the buffer was changed and left overnight. The dialysis step exchanges the protein into a storage buffer rather than the cleavage buffer. The column was regenerated by washing with 10 column volume s of 0.3 M NaOH, with a 30 minute incubation a fter 15 mL had passed through Then 20 column volume s of DI water and 5 volume s of column buffer followed. The column was stored in 4 C. After collecting the elutions from the dialysis tubes, a Lowry assay was performed using BS A standards. A Bio Rad kit was used to prepare the samples. One hundred L of 0.2, 0.5, 0.8, 1.1, and 1.5 mg/mL samples of bovine serum albumin (BSA) were combined with 500 L reagent A with vortexing, and 4 mL reagent B with vortexing. Samples were all owed to incubate for 15 minutes before measuring the absorbance at 750 nm in a spectrophotometer. A background sample was made with dialysis buffer.

PAGE 46

36 Three SDS PAGE gels were run to test the purification of the enzyme : two gels contained the purification samples, one for Coomassie Blue staining and one for Western blott ing. A second gel was run for staining with C oomassie Blue that contained the elutions. A Western of the elutions was not run because in theory the Westerns would not show any band. The primary antibody of the Western binds to the chitin binding domain tag, which the eluted protein would not have. Crude lysate and pellet samples were combined with 100 L 1X SDS Loading Buffer and boiled for 5 minutes. To prepare the column fractions, a pipet tip was used to scoop ~100 L resin both before and after the elution of protein. The resin was combined with 50 L 3X SDS Loading Buffer, boiled for 5 minutes, centrifuged, and 10 L was loaded in the gel (IMPACT kit Instruction Manual). All liquid samples had 40 L combined with 20 L 3X SDS Loading Buffer and were also boiled for 5 minutes The Western was developed according to the previously outlined procedure. A second purification was run with the remainin g cell pellets from the overexpression. The purification w as the same as previously described but with three times as much protein. Only the modifications from the original procedure will be described. Two columns of chitin beads were used to collect p rotein, and the cleavage was allowed to sit 19 hours at 4 C before eluting. Three fractions of 1 mL elutions were taken from each column rather than s ix. Dialysis time was 7 hours i n the first buffer with shaking in 4 C, then the buffer was changed and the dialysis continued overnight. Three SDS PAGE gels were run with samples from the second purification

PAGE 47

37 An endogenous GPD protein purification was ultimately used for the kinetics measurements described below The protein was prepared from a mixed s tage population of C. elegans grown on egg plates, and was partially purified using gel filtration followed by blue sepharose chromatography. 2.11: Kinetics Kinetics experiments were r u n with all six elutions from the first purification, and on the six elutions from the second purification. Kinetics was tested on a n OLIS upgraded CARY 14 spectrophotometer measuring the absorbance at 340 nm over time. The rate of appearance of NADH from NAD + is visible at this frequency, and other reagents do not interf ere at this wavelength Other students experimented with reaction conditions and found an optimal condition for kinetic s r eactions. These conditions we re not the o ptimized conditions, but they did give the expected rates from a commercial preparation of the enzyme ( K. Walstrom, personal communication). These conditions were used for all kinetics reacti ons involving GPD 3. Testing the kinetics was performed to get Michaelis Menten curves for both G3P and NAD + Analysis of the data was performed in Origi n, a commercially available software package. The Michaelis Menten equation was solved directly in Origin to get a K m through computation from estimated values of the K m and V max

PAGE 48

38 Chapter 3: Results 3.1: Overview The vector pTYB11 was successfully ligated to the insert of the gpd 3 cDNA sequence Following ligation, the plasmid was successfully transformed into Rosetta cells and overexpressed. The cells were lysed and the protein was loaded over a chitin column. SDS PAGE gels were stained with Coomassie Blue and Western procedures to visualize the purification. The fusion protein did not cleave on the column, and a separate preparation of GPD 3 was used for kinetics experiments. All DNA quantitation samples were measured using the following methods unless otherwise specified. The samples were tested as 1 L sample in 110 L TE, and a baseline of TE was subtracted from the sample. Absorbance was measured from 230 to 350 nm, and the values of 230, 260, 280, a nd 350 nm were record ed. The absorbance around 350 sh ould be a flat line at the lowest value of the whole graph. This value was also subtracted from the 230, 260, and 280 nm values to get a more accurate measurement of the absorbance on a scale starting from 0. The absorbance rat io of A260/280 is used to test for protein contamination of the samples, since proteins typically absorb at 280 nm. The absorbance ratio of A260/230 is used to test the purity of the sample in terms of other organic molecules us ed during the DNA preparation, such as phenolate. Pure samples should show a A260/230 and a A260/280 ratio greater than 2. To quantify the amount of DNA a standard value for pure DNA was used. At A260 = 1, this concentration is 50 g/mL This value ca n be used to accurately calculate

PAGE 49

39 the amount of DNA using the formula c = A260 x 50 g/mL x 110, where c is the molar concentration, A260 is the absorbance at 260 nm, and 110 is the dilution factor of 1 L sample in 110 L TE. 3.2: Preparation of gpd 3 To properly run a PCR to amplify the gpd 3 gene, the concentration of the gel purified primers was determined from the A260 (Table 3.1). The primers were purchased from Integrated DNA Technologies (IDT), who provided extinction coefficients for each prime r: forward = 450 200/M cm, reverse = 432 Law reveals that A = lc, where A is absorbance, is the extinction coefficient in 1/ ( M cm ) l is path length (typically 1 cm for our cuvettes ), and c is molar concentration. In this case, the co ncentration of the forward primer was 0.1645 mM the concentration of the reverse primer was 0.0794 mM (Table 3.1) The ratios of A260/230 and A260/280 in all cases app ear ed to show the DNA products could be considered mostly pure DNA. It is not known wh y the forward primer ha d a final concentration of more than double the reverse primer (0.1645 mM to 0.0794 mM), because both samples were initially brought to 300 M and had 50 L purified. The most likely possibility for this result is that each primer h ad a different amount of the primer cut out of the gel. Next, a PCR reaction was performed to amplify the gpd 3 gene. Figure 3.1 shows the results of the reaction. Since the gpd 3 gene is 1,026 bp long, a band should appear around the 1,000 bp band on the ladder. The PCR was successful in the cDNA sample

PAGE 50

40 from wild type (N2) worms grown at 22 C, with an observable band around 1,050 bp, but not in the other two samples. The 22 C sample was successful, so this cDNA was used again in a larger scale PCR to Wavelength (nm) Absorbance at 230 Absorbance at 260 Absorbance at 280 Concentration ( mM) Forward primer 0.4979 0.8796 0.5293 Baseline 0.189 0 0.2125 0.2165 Adjusted forward primer 0.3089 0.6671 0.3128 0.1645 Reverse primer 0.3329 0.5206 0.3771 Baseline 0.1847 0.2110 0.2163 Adjusted reverse primer 0.1482 0.3096 0.1208 0.0794 Table 3.1: Quantitating the amount of forward and reverse primers. The blank for each value was subtracted from the original measurement, and that adjusted value was used to calculate the amount of DNA present. E xtinction coefficients of forward = 450200 and reverse = 432600 primers were provided by Integrated DNA Technologies (IDT) obtain a large amount of gpd 3 DNA that could be purified. Figure 3.2 shows the same band as in figure 3.1, running at 1,100 bp. The size difference could be because the gels are not running with an equally distributed voltage causing the exterior lanes to run more quickly than the interior lanes (observed in gels run later, K. Walstrom, personal communication) or because the size standards are not straight bands

PAGE 51

41 Figure 3.1: The PCR product of three different cDNA stocks, screening for non degraded cDNA. The cDNA was from C. elegans grown at 15C, 22C, and C. elegans grown without Mn in the buffer. (The worms were originally grown for a different experiment.) T he sampl es were run on a 1% agarose gel. The band observed in the 22 C lane was the correct size (1026 bp) and this DNA was used in a larger PCR experiment. LADDER 1 5 22 Mn 12,000 5 ,000 2 ,000 1,650 1 ,000 85 0 5 00 1 00

PAGE 52

42 Figure 3.2: The PCR product of th e large reaction running on a 1 % agarose gel. The band observed in the 22 C lane is the same mass as in Figure 3.1 and is the gene gpd 3 from the cDNA of C. elegans The band appears at ~1,100 bp, and gpd 3 is expected at 1,026 bp, suggesting that the observed band is gpd 3 After the PCR product was purified, the DNA was quantitated. Table 3.2 shows the results of the quantitation. Both purification samples from the purification column were quantitated. Only the fi rst sample from the column had a significant amount of DNA, so the second sample was discarded. The concentration of PCR product was calculated to be 46.2 g/mL. LADDER 22 12,000 5 ,000 2 ,000 1,650 1 ,000 85 0 5 00 1 00

PAGE 53

43 Wavelength (nm) Absorbance at 230 Absorbance at 260 Absorbance at 280 Concentration ( g/m L) PCR product sample 1 0.0119 0.0105 0.0062 Baseline 0.0021 0.0021 0.0021 Adjusted PCR product sample 1 0.0140 0.0084 0.0041 46.2 PCR product sample 2 0.0113 0.0030 0.0056 Baseline 0.0040 0.0040 0.0040 Adjusted PCR product sample 2 0.0153 0.001 0.0016 5.5 Table 3 .2 : Quantitating the amount of purified PCR product The blank for each value was automatically subtracted from each sample by the spectrophotometer. A baseline was taken to be the value of absorbance around 350 nm, which had no peaks and was typically a flat line of the lowest value. This also was subtracted from the original measurement, and that adjusted value was used to calculate the amount of DNA present. The standard value of pure DNA at A260 = 1 has a concentration of 50 g/mL, which was used to calculate the product concentrations. The second sample was discarded because it did not contain a detectable amount of DNA. Restriction digests were used throughout the purification process as a tool to create sticky ends fo r annealing and ligation, as well as a way to check for properly sized bands of DNA. Figure 3.3 shows the restriction digest map of the gpd 3 gene, as well as the plasmid pTYB11.

PAGE 54

44 Figure 3 .3: Restriction digest map of (A) gpd 3 and (B) pTYB11. A B

PAGE 55

45 To test if the isolated DNA obtained in the large scale PCR reactions was actually gpd 3 a restriction digest was performed with enzymes that are known to cut gpd 3 : EcoRI and SacI. The EcoRI should cut gpd 3 into pieces of 800 and 200 bp, SacI should c ut gpd 3 into pieces of 700 and 300 bp, and both fragments should produce fragments of 150, 200, and 700 bp Figure 3.4 shows the results of the restriction digest. It appears that the SacI enzyme was inactive because the SacI lane matched the uncut lane and because the SacI + EcoRI lane matched the EcoRI lane. With a larger excess of restriction enzyme, it is possible that this enzyme would have shown bands of cut DNA. Because the EcoRI lane showed bands at 200 and 1,000 bp, there was evidence support ing the conclusion that gpd 3 was present, even though the 1,000 bp band was running near a larger size standard than expected.

PAGE 56

46 Figure 3.4 : The PCR product gpd 3 was cut with restriction enzymes EcoRI and SacI on a 1 % agarose gel. The SacI was thought to be inactive due to the SacI lane looking identical to the uncut lane, and the SacI and EcoRI lane looking identical to the EcoRI lane. EcoRI cut the plasmid, showing two bands expected at 200 and 800 bp, which was taken as evidence that gpd 3 was present. The large scale restriction digest of the purified PCR product with restriction enzymes SapI and XhoI was performed, and the PCR product was purified and quantitated. The results are shown below in table 3.3. Two samples were taken from the purification column, with only the first sample showing good results. The second sample contained too much protein contamination indicated by its low A260/280 ratio. The final concentration of gpd 3 in sample 1 was calculated to be 42.9 g/mL. LADDER uncut EcoRI SacI EcoRI + SacI 12,000 5 ,000 2 ,000 1,650 1 ,000 85 0 5 00 10 0

PAGE 57

47 Wavelength (nm) Absorbance at 230 Absorbance at 260 Absorbance at 280 Concentration ( g/mL) gpd 3 sample 1 0.0105 0.0160 0.0116 Baseline 0.0082 0.0082 0.0082 Adjusted gpd 3 sample 1 0.0023 0.0078 0.0034 42.9 gpd 3 sample 2 0.0007 0.0074 0.0070 Baseline 0.0056 0.0056 0.0056 Adjusted gpd 3 sample 2 0.0049 0.0018 0.0014 N/A Table 3 .3 : Quantitating the amount of cut and purified gpd 3 The b lank for each value was automatically subtracted from each sample by the spectrophotometer. A baseline was taken to be the value of absorbance around 350 nm, which had no peaks and was typically a flat line of the lowest value. This also was subtracted from the original measurement, and that adjusted value was used to calculate the amount of DNA present. The standard value of pure DNA at A 260 = 1 has a concentration of 50 g/mL, which was used to calculate the product concentrations. gpd 3 sample 2 was shown to be significantly contaminated by its low A260/280 ratio, so this sample was discarded 3.3: Preparation of pTYB11 The plasmid pTYB11 was isolated and purified from bacteria. The DNA was quantitated using a spectrophotometer. The results are shown in table 3.4 below. The plasmid had a concentration of 6.3 mg/mL. This was diluted to prevent precipitation. Following quantitation, the plasmid was cut with restriction enzymes XhoI and SapI to test the sequence of the purified plasmid DNA. The uncut plasmid is circular, so it travels shorter distances than linearized pieces of DNA. SapI and XhoI were expected to linearize the plasmid by cutting once and the double digest was expected to create a 33 bp DNA fragment (not visible on a gel due to its sma ll mass) and a 7,400 bp fragment. All digested samples have bands appearing at the same position.

PAGE 58

48 Wavelength (nm) Absorbance at 230 Absorbance at 260 Absorbance at 280 Concentration ( m g/mL) Plasmid 0.5426 1.1679 0.5832 Baseline 0.014 0.014 0.014 Adjusted plasmid 0.5286 1.1539 0.5692 6.346 Table 3 .4 : Quantitating the amount of plasmid DNA The b lank for each value was automatically subtracted from each sample by the spectrophotometer. A baseline was taken to be the value of absorbance around 350 nm, which had no peaks and was typically a flat line of the lowest value. This also was subtracted from the original measurement, and that adjusted value was used to calculate the amount of DNA present. The standard value of pure DNA at A260 = 1 has a concentration of 50 g/mL, which was used to calculate the product concentrations. Figure 3. 5 : The vector pTYB11 run on a 0.8% agarose gel, cut with the restriction enzymes SapI and XhoI. Although a ladder was not run with the samples, i t can be seen that each res triction enzyme has cut the plasmid. Because there is only a 33 bp difference in the sequence between XhoI and SapI, it is not expected that those digest products would run at different masses. This provides evidence to support the conclusion that the pl asmid is pTYB11 and the correct sequence has been purified. Following the positive results from the initial restriction digest, a large scale restriction digest with the vector was performed with SapI and XhoI, and the cut plasmid No Uncut XhoI plasmid SapI Sap I +Xho I

PAGE 59

49 was purified using a crystal violet gel. Attempts to quantitate the DNA purified from the gel using its absorbance at 260 nm suggested the DNA was contaminated and at a low concentration, so an agarose gel was run using known concentrations of the uncut plasmid as a mass sta ndard. The amounts of DNA in the purified samples was measured by quantitating band intensities using the free software GelQuantNET ( http://biochemlabsolutions.com/GelQuantNET.html ). Results are shown in table 3.5. The 100, 200, and 300 ng of DNA lanes are have more intense bands than the test samples, meaning the test samples are all outside the measurable range of the calibration curve. The curve was still used to estimate the concentration of DNA in the samples, and a ligation transformation was per formed based on the results. Samples S2 1, S1 1, S1 2, and S1 3 were combined and averaged to an estimate d concentration of 50 g/mL. The first number of each sample label refers to the purification it came from, and the second number refers to the elution number.

PAGE 60

50 Figure 3.6 : The vector pTYB11 run on a 0.8% agarose gel Lanes 2 4 are known amounts of plasmid DNA, run to create a standard curve for the amount of DNA in the other lanes. A software package GelQuantNET was used to measure the intensities of each band, and calculations were made to estimate the amount of D NA in each lane. The four most visible sample bands were all combined and estimated to be 50 g/mL. Sample Estimated DNA concentration ( g/mL) S2 1 58 S1 1 44 S1 2 52 S1 3 45 Table 3 .5 : Quantitating the amount of cut plasmid DNA purified from a crystal violet gel The estimates of DNA concentration were calculated by measuring the intensities of each band and comparing it to the calibration established by 100, 200, and 300 ng of uncut plasmid DNA. Refer to the text and figure 3.6 for further ex planation. LADDER 200 ng S2 1 S2 2 S1 1 S1 2 S1 3 S1 4 S1 5 S1 6 100 ng 300 ng 12,000 5 ,000 2 ,000 1,650 1 ,000 85 0 5 00 10 0

PAGE 61

51 3.4: Ligation transformation of gpd 3 and pTYB11 The gpd 3 gene was ligated into the pTYB11 plasmid, and this ligation mixture was transformed into Top10 E. coli The number of colonies that grew after plating the transformation reactions was counted. The ligation transformation was run with a negative control that lacked a PCR insert. This control measured how well the pTYB11 vector could anneal to itself to c reate a circular plasmid that would transform into E. coli cells. The results, which suggest the plasmid was primarily transformed only when the PCR insert was included, are shown in table 3.6. T herefore, the PCR was successfully ligated into pTYB11 and the newly circularized plasmid was taken up by the Rosetta cells. Plates showed the number of resulting colonies : Amount of media plated + PCR Insert PCR Insert 50 L 2 1 200 L 29 5 500 L 27 5 Table 3 .6 : Number of colonies grown from the ligation transformation. The plates all contained ampicillin as a means of select ing the resulting colonies. Only colonies with the PCR insert should have received the plasmid. 3.5: Full plasmid preparation Four colonies were grown from the +PCR insert transformation plates, and the plasmid in each of them was purified independently. The redundancy of the samples was a way to have a higher probability that the correct plasmid sequence would be in at

PAGE 62

52 least on e of the samples. The concentration of plasmid DNA in each sample was quantitated, and the results are shown in table 3.7. Figure 3. 6 shows the uncut plasmid was much higher in intensity than the other two plasmids, probably due to a calculation error w hich inadvertently loaded more than was needed Samples 1 and 4 were quantitated incorrectly and initially appeared to have protein contamination according to the A260/280 ratios, so only samples 2 and 3 were used in further experimentation. To test if t hese samples containe d the proper DNA sequence, a restriction digest was performed with enzymes XhoI, SapI, and NcoI. Figure 3.7 shows the results of the restriction digest s. These were performed with the original plasmid (OP) (the same plasmid shown i n table 3.4) which is missing the gpd 3 insert and with the plasmid samples 2 and 3 (S2 and S3) which should have the gpd 3 insert. The OP lanes have significantly more DNA in them than S1 and S2, but the important information is the presence or absence o f specific bands. The XhoI and SapI cuts should give bands at 7400 and 1000 bp, while the XhoI and NcoI cuts should give bands of 1500 and 6900 bp. Both samples 2 and 3 show two bands for the XhoI + SapI and the XhoI + NcoI reactions, signaling that they were both cut in two places by the enzymes. The lack of similar bands in the pre ligation plasmid confirms that plasmid as having a separate sequence from the post ligation plasmids. Because S2 and S3 have matching bands and because the bands are the size expected based on the restriction map, it wa s concluded they both contain gpd 3

PAGE 63

53 To confirm with greater accuracy the samples were the correct sequence and that gpd 3 was properly in frame with the fusion protein, the DN A sequence of samples 2 and 3 were obtained The sequencing results can be found in Appendix B. The results show that the gpd 3 gene sequence f rom wormbase matches with 100.0 % accuracy to the sequence of the fusion protein that corresponds to gpd 3 and that gpd 3 is in frame with pTYB11 codons. Wavelength (nm) Absorbance at 230 Absorbance at 260 Absorbance at 280 Concentration ( g/mL) plasmid sample 1 0.0473 0.0596 0.0499 Baseline 0.0362 0.0362 0.0362 Adjusted plasmid sample 1 0.0111 0.0234 0.0137 128.7 plasmid sample 2 0.0136 0.0185 0.0075 Baseline 0.000 0.000 0.000 Adjusted plasmid sample 2 0.0136 0.0185 0.0075 101.8 plasmid sample 3 0.0266 0.0096 0.0019 Baseline 0.0026 0.0026 0.0026 Adjusted plasmid sample 3 0.0240 0.0122 0.0045 67.1 plasmid sample 4 0.0238 0.0242 0.0092 Baseline 0.0059 0.0059 0.0059 Adjusted plasmid sample 4 0.0179 0.0301 0.0151 165.6 Table 3 .7 : Quantitating the amount of plasmid DNA The b lank for each value was automatically subtracted from each samp le by the spectrophotometer. A baseline was taken to be the value of absorbance around 350 nm, which had no peaks and was typically a flat line of the lowest value. This value was subtracted from the original measurement, and that adjusted value was used to calculate the amount of DNA present. The standard value of pure DNA at A260 = 1 has a concentration of 50 g/mL, which was used to calculate the product concentrations. Sample s 1 and 2 were i nitially considered contaminated due to a low A260/280 ratio but after the samples were re analyzed, the samples appeared pure enough

PAGE 64

54 Figure 3.7 : The restriction digests of the ligat ed sample s 2 and 3 (S2 and S3) and the original pre ligation plasmid (OP) were run on a 0.8 % agarose gel The OP lanes have significantly more DNA in them than S1 and S2, but the important information is the presence or absence of bands. S2 and S3 show 2 b ands when cut with XhoI and SapI, with one band representing the uncut O P, and the other band representing the gpd 3 insert. As the OP has no gpd 3 insert, only 1 band results from the XhoI and SapI cut Multiple bands on the XhoI + NcoI lanes also suggest the full insert was successfully ligated into the plasmid. Because S 2 and S3 match in band placement, it is concluded they have the gpd 3 insert. 3.6: Test induction of Rosetta cells Next, the protein GPD 3 was overexpressed in E. coli cells. To determine which conditions gave the most express ion of GPD 3, a test induction wa s done under with multiple conditions. Results of the test induction are shown below in figures 3.8 and 3.9. Two protein detection methods were used in an attempt to provide multiple sources of confirmation for the best conditi ons. The Cooma ssie Blue stain wa s more OP uncut OP XhoI + SapI S2 uncut S2 XhoI + SapI S3 uncut S3 XhoI + SapI OP XhoI OP XhoI + NcoI S2 XhoI S2 XhoI + NcoI S3 XhoI S3 XhoI + NcoI

PAGE 65

55 difficult to interpret than the Western blot because most of the bands and lanes ran together, but both gels have bands across 50 and 85 kDa. The fusion protein is expected around 93 kDa. The 85 kDa band is thought to be the fusi on protein, and there is no lane in figure 3.9 that has a noticeably darker band than the others. The 4 hour time point at 37C was chosen for a large scale induction because of its convenience and its usefulness in previous protein inductions Figure 3.8 : T est induction of the Rosetta cells at 0.4 mM IPTG, stained with Coomassie Blue. Samples of 2 through 6 hours were kept at 37 C, and samples of 16 through 20 hours were kept at room temper refers to a negative control of uninduced expression, a sample with no IPTG added. Bands of 82 and 50 kDa are intense through all samples, although it is difficult to completely distinguish individual lanes on this gel. 190 120 85 60 50 40 0 h r 2 hr 4 hr 6 hr 4 hr unind ladder 16 hr unind 12 hr 16 hr 20 hr

PAGE 66

56 Figure 3.9 : T est induction of the Rosetta cells at 0.4 mM IPTG, stained with Western blotting. Samples of 2 through 6 hours were kept at 37 refers to a negative control of uninduced expression, a sample with no IPTG added. The intense bands of 82 and 50 kDa are seen across all samples. It is thought that the 93 kDa band of the fusion protein is the band running at 82. The other proteins are all endogenous E. coli proteins. 3.7: Small scale purification of Rosetta cells A 1 L growth of cells was performed for the protein purification. The purifications were performed in t wo sets; the small scale was 25 % of the cells and the l arge scale was the remaining 75 %. In the small scale purification, Coomassie Blue and Western staining protocols were used to visualize the results of purification. Intense bands in the Coomassie Blue gel (figure 3.10) are seen at 50 and 85 kDa, and no bands 190 120 85 60 50 40 0 hr 2 hr 4 hr 6 hr 4 hr unind ladder 16 hr unind 12 hr 16 hr 20 hr

PAGE 67

57 are observed in the wash, quick flush or resin samples. The Western blot (figure 3.11) only showed a band at 85 kDa that extends a cross all lanes. The fusion protein should be in the pre cleavage samples at 93 kDa, and the chitin binding domain should remain in post cleavage samples as 37 kDa. Figure 3.10 shows the fusion protein in all samples. Figure 3.10 : Small scale purification of the Rosetta cells, stained with Coomassie Blue. Lane abbre viations are as follows: crude is crude lysate, clarified is clarified lysate, FT is flow through, QF is quick flush, and resin after is a sample of the resin after elution. Many proteins are visible in the clarified and flow through lanes, but none are v isible in the wash, QF, and resin lanes. 190 120 85 60 50 40 25 pellet crude clarified ladder FT wash QF resin after

PAGE 68

58 Figure 3.11 : Western blot of the small scale purification of GPD 3 from the Rosetta cells. Lane abbreviations are as follows: crude is crude lysate, clarified is clarified lysate, FT is flow t hrough, QF is quick flush, and resin after is a sample of the resin after elution. A band at 84 kDa is present in all samples. This band is thought to be the fusion protein GPD 3 + intein + CBD. 3.8: Large scale purification of Rosetta cells The large scale purification had much the same results as the small scale purification, with som e exceptions. Figure 3.12 showed that the resin samples both before and after contained the GPD 3 + intein fusion protein at 85 kDa. There may be a small amount o f cleaved protein in sample RA C1, but it is a small amount. 190 120 85 60 50 40 pellet crude clarified clarified ladder FT wash QF resin after

PAGE 69

59 Figure 3.12 : Large scale purification of the Rosetta cells, stained with Coomassie Blue. Lane abbreviations are as follows: pellet is crude lysate, clar. is clarified, clar. pellet is the pellet fraction from spinning the crude lysate, C1 and C2 refer to which column the protein was purified on, FT is flow through, RB and RA are samples of resin before and after elution. GPD 3 is seen in the band at 85 kDa as a fusion protein. Figure 3.13 shows the same samples as 3.12 stained by Western blot instead of Coomassie Blue. In this gel, the 85 kDa band is present in all resin samples and no cleaved chitin binding domain was present Elution samples stained with Coomassie Blue in f igure 3.14 show ed no detectable proteins. 190 120 85 60 50 40 25 pellet c lar. pellet cla r. lysate ladder FT C1 FT C2 wash C1 RB C2 RA C1 RA C2

PAGE 70

60 Figure 3.13 : Large scale purification of the Rosetta cells, stained by Western blotting. Lane abbreviations are as follows: pellet is crude lysate, clar. is clarified, clar. pellet is the pellet fraction from spinning the crude lysate, C1 and C2 refer to which column the protein was purified on, FT is flow through, RB and RA are samples of resin before and after elution. GPD 3 is seen in the band at 85 kDa as a fusion protein. 190 120 85 60 50 40 25 pellet c lar. pellet cla r. lysate ladder FT C1 FT C2 wash C1 RB C2 RA C1 RA C2

PAGE 71

61 Figure 3.14 : Elutions from the large scale purification of GPD 3. The C number refers to which column the protein eluted from, and each column had th ree elutions, E1 E3. No bands we re observable in these samples. 3.9: Kinetics of GPD 3 At this point in the experiment, it became clear that no detectable protein was in the elution samples because the fusion protein did not cleave under the conditions used. Another group of student researchers h ad purified GPD 2 and GPD 3 directly from C. elegans Kinetics meas urements were performed on the protein from that preparation, and are presented below. 190 120 85 60 50 40 25 C1E1 C1E2 C1E3 C2E1 C2E2 C 2E3 ladder

PAGE 72

62 Figure 3 .1 5 : Michaelis Menten curve of G3P. The V max was calculated to be 4 mol/min and the K m was calculated to be 0.3 mM.

PAGE 73

63 Figure 3.1 6 : Michaelis Menten curve of NAD + Th e V max was calculated to be 5 mol/min, and the K m was calculated to be 1.4 mM

PAGE 74

64 Chapter 4: Discussion 4.1: Test induction of Rosetta cells Figures 3.8 and 3.9 show the test induction conditions for the Rosetta cells. Looking at both figures, there is no clearly visible protein band that is overexpressed in the induced cells that is not expressed in the uninduced cells. The uninduced cells o f figure 3.8 show more protein than the induced cells, and it is difficult to discern individual bands. The Western blot is more useful, showing that there is not a significant difference in any of the induction samples. The 4 hour 37 C sample was chose n to be a large scale growth for its common effectiveness in previous protein overexpression experiments In future purifications, this reaction should be tested in multiple ways. Different concentrations of IPTG should be used to test for expression lev els, and there should be a band that is more distinguishably not present in the uninduced samples, but present in the induced samples. Having such a result would provide evidence not only that the fusion protein is being made in the induced samples, but a lso which conditions overexpress the most protein. To further elucidate the best conditions, a parallel test should be run in pTYB11 transformed cells without the gpd 3 insert. By including this negative control, it should be more readily apparent where the bands of overexpressed protein are.

PAGE 75

65 4.2: Small scale purification of Rosetta cells It is notable that there is no band of protein in the expected 93 kDa region in the figure 3.10 wash, quick flush, and resin samples. This suggests that the protein s tuck to the column and did not elute in the wash phase or quick flush phase, but was still attached to the resin However, the resin after cleavage should show some of the fusion protein around the 55 kDa region or the remaining chitin binding domain if t he GPD 3 properly cleaved and eluted. As a Western blot, figure 3.11 has a higher detection capability than the Coomassie Blue gel. The presence of the 85 kD a band suggests that the GPD 3 wa s still fused to the intein tag and never cleaved from the resin. A missing band around 50 kDa for gpd 3 and around 30 kD a for the chitin binding domain supports this conclusion. 4.3: Large scale purification of Rosetta cells Figures 3.12 and 3.13 show some unexpected results. Figure 3.12 shows the same 85 kDa band in the resin samples before elution and after elution. This suggests that there was protein which did not cleave from the column and elute. In the resin after sample of column 1, there is a faint band around 45 kDa which may be the intein tag and CBD after the GPD 3 has eluted. The Western blot in figure 3.13 is harder to interpret. There are two bands around 85 kDa and 70 kDa for all resin samples. The 85 kDa is still the fusion protein, however, the 70 kDa sample is more confusing, because it

PAGE 76

66 means the intein tag is present at that mass It is believed that this band is partially cleaved protein or a degradation product If the protein cleaved, there should have been a strong chitin bi ndi ng domain band visible around 56 kDa. The column was stripped before the Western was run, so all protein stuck to the column was lost. It would have been possible to save and elute the protein had the column not been cleaned before the gel results wer e analyzed. At this point, endogenous GPD from C. elegans purified by another group of students was used for kinetics analysis. The elution sample E3 had the most protein and was used for kinetics. Their protein was directly purified from C. elegans so it is not certain how much GPD 3 is present compared to GPD 2. However, it is probable the GPD analyzed is not GPD 1 or GPD 4, because those forms are typ ically found only in embryonic worms (Huang et al., 1989; Yarbrough and Hecht, 1984). In future pur ifications, the protein should be eluted using a more effective method. Potential methods for cleavage include cleaving with a longer reaction time, using a higher temperature for the cleavage reaction, or by using a different plasmid system that has a di fferent intein tag, such as pTYB21. GPD 3 is very sensitive to temperature, so a higher reaction temperature could be damaging to the protein. To prevent losing protein, a Western blot of the purification including a resin after sample should be run befo re the column is stripped

PAGE 77

67 4.4: Kinetics of GPD 3 Figures 3.15 and 3.16 we re used to calculate the V max and K m for the substrates G3P and NAD + respectively. Both sets of data had major outliers removed from analysis, but it is clear that more data point s need to be collected. These non linear fits to the Michaelis Menten equation provide rough estimates for the V max and K m values Two data sets were collected before it was realized a reagent was degrade d and all the data had to be collected again. Due to this problem the amount of protein remaining was not sufficient to complete all kinetics or to complete the Lowry assay, so the concentration of protein used in the kinetics experiments could not be determined Previous literature results of kin etics on GPD enzymes have shown a large range of values for the NAD + K m values and the G3P K m values, as shown in table 4.1 (Maurer et al., 1983). The K m values obtained for the kinetics of the C. elegans GPD 2/GPD 3 mixture are high in comparison for NAD + as shown in table 4.1, but the values for the C. elegans G3P K m are only slightly higher than the GPD enzymes from the other sources. We performed our kinetics assays over a wide range of NAD + concentration to try to get the best estimate of the K m but clearly more experiments should be performed.

PAGE 78

68 Organism K m ( M) NAD + K m ( M) G3P Specific Activity (U/mg) Rabbit (1) 13 90 164 Yeast (2) 44 160 100 E. coli (3) 166 142 40 S. arenae PL sensitive (4) 110 250 112 S. arenae PL insensitive (4) 120 100 33 C. elegans 1 400 300 ND Table 4 .1: K m values of GAPDH for NAD + and G3P from various organisms. ND means not determined. PL is p entalenolactone. This table was modified from Maurer et al., 1983. (1) = Furfine and Velick, 1965. (2) = Velick and Udenfriend, 1953. (3) = Ales si o and Josse, 1971. (4) = Maurer et al., 1983.

PAGE 79

69 Chapter 5: Conclusions This project aimed to characterize the C. elegans protein GPD 3 by inducing overexpression of a fusion protein in E. coli The protein was purifie d using the IMPACT system. Results showed the plasmid was successfully ligated with the gpd 3 gene at the appropriate site. However, the fusion protein that resulted was resistant to cleavage on the chitin column. The IMPACT purification system cites the vector pTYB11 as one that is difficult to cleave, and suggests another vector, pTYB21, to take its place. With this in mind, there were two main flaws in the experimental design. First, the pTYB11 vector should not have been used, because another vector was shown by NEB to have more efficient cleavage. Second, the column should never have been cleaned until it was certain the GPD 3 had eluted. Even though no protein was obtained through the column purification, there was an endogenous purification of what is thought to be primarily GPD 2 and GPD 3. This protein showed consistent kinetics results, and approximate K m values for NAD + and G3P were obtained. Future work on this research project has multiple potential directions. More endogenous purifica tions would provide protein quickly and additional kinetics experiments could be run. However, since the relative amounts of GPD 1, GPD 2, GPD 3, and GPD 4 are unknown in these samples, it would perhaps be better to approach the problem in a different wa y. The complete gpd 3 plasmid was shown to contain the proper sequence so another preparation and purification of protein from this plasmid

PAGE 80

70 should be relatively straightforward, so long as the cleavage was monitored. A third option would be to insert th e gpd 3 gene into another plasmid, such as pTYB21, and puri fy the protein from an overexpression of cells with that plasmid. If the last route is chosen, this research project would serve as a template for the process.

PAGE 81

71 References Alessio G and Josse J. 1971. Glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase and phosphoglyceromutase of Escherichia coli J. Biol. Chem. 246: 4319 4333. Ashmarina L I, Muronetz VI, and Nagradova NK 1982. Evidence for a change in catalytic properties of glyceraldehyde 3 phosphate dehydrogenase monomers upon their association in a tetramer. FEBS letters 144 (1): 43 46. Ashrafi K. 2007. Obesity and the regulation of fat metabolism. WormBook, ed. The C. elegans Research Community, WormBook. Baca AM and Hol WG. 2000. Overcoming codon bias: a method for high level overexpression of Plasmodium and other AT rich parasite genes in Escherichia coli. Int. J. Parasitol. 30 (2): 113 118. Barber RD, Harme r DW, Coleman RA, and Clark BJ 2005. GAPDH as a housekeeping gene: analysis of GAPDH mRNA expression in a panel of 72 human tissues. Physiol. Genomics 21 ( 3): 389 395. Bell JE and Dalziel K. 1975. Conformational changes of glyceraldehyde 3 phosphate dehydrogenase induced by the binding of NAD + A unified model for positive and negative cooperativity. Biochimica et Biophysica Acta 410: 243 251. Berg J, Tymoczko JL, and Stryer L 2007. Biochemistry. 6 th ed. W.H. Freeman and Co., New York, NY. Brenner S 1974. The genetics of Caenorhabditis elegans Genetics 77: 71 94. Butterfield DA, Hardas SS, and Lange MLB 2010. Oxidatively modified glyceraldehyde 3 phosphate dehydrogenase (GAPDH) and Alzheimer disease: many pathways to neurodegeneration. J. Al zheimers Dis. 20 (2): 369 393. The C. elegans Sequencing Consortium. 1998. Genome sequence of the nematode C. elegans : A platform for investigating biology. Science 282: 2012 2018. Chong S, Montello GE, Zhang A, Cantor EJ, Liao W, Xu M Q and Benner J. 1998. Utilizing the C terminal cleavage activity of a protein splicing element to purify recombinant proteins in a single chromatographic step. Nucl. Acids Res. 26: 5109 5115.

PAGE 82

72 Cowan Jacob S W, Kaufmann M, Anselmo AN, Stark W, and Grutter MG 2003. Struc ture of rabbit muscle glyceraldehyde 3 phosphate dehydrogenase. Acta Cryst. 59 (12): 2218 2227. Cyrne L, Antunes F, Sousa Lopes A, Diaz Berrio J, Marinho HS 2010. Glyceraldehyde 3 phosphate dehydrogenase is largely unresponsive to low regulatory levels of hydrogen peroxide in Saccharomyces cerevisiae BMC Biochemistry 11 (49). Eisenberg E and Levanon EY. 2003. Genome analysis Human housekeeping genes are compact. Trends in Genetics, 19 (7): 362 365. Furf ine CS and Velick SF. 1965. The acyl enzyme intermediate and the kinetic mechanism of the glyceraldehyde 3 phosphate dehydrogenase reaction. The Journal of Biological Chemistry 240 (2): 844 855. Gafni A. 1979. The interaction of adenine with its binding site in rabbit muscle glyceraldehyde 3 phosphate dehydrogenase studied by fluorescence decay. Biochemical and biophysical research communications 86 (2): 285 292. Gu W. 2011. B.A. thesis, New Colleg e of Florida, Sarasota, FL. Harris JI and Waters M. 1976. Glyceraldehyde 3 phosphate dehydrogenase. The Enzymes (Boyer, P. D., ed) 3rd Ed., 13: 1 50. Academic Press, New York. Henis YI and Levitzki A. 1977. The role of the nicotinamide and adenine su bsites in the negative co operativity of coenzyme binding to glyceraldehyde 3 phospahte dehydrogenase. Journal of Molecular Biology 117 (3): 699 716. Henis YI and Levitzki A. 1980. Mechanism of negative cooperativity in glyceraldehyde 3 phosphate dehydr ogenase deduced from ligand competition experiments. Proc. Natl. Acad. Sci. USA 77 (9): 5055 5059. Huang X, Barrios LAM, Vonkhorporn P, Honda S, Albertson DG, and Hecht RM 1989. Genomic organization of the glyceraldehyde 3 phosphate dehydrogenase gene family of Caenorhabditis elegans J. Mol. Biol. 206: 411 424. Invitrogen. 2001. S.N.A.P. UV Free Gel Purification kit. Version B. Jenk ins JL and Tanner JJ. 2006. High resolution structure of human d glyceraldehyde 3 phosphate dehydrogenase. Acta Cry st. 62 ( 3 ) : 290 301.

PAGE 83

73 Krawczyk E, Broda K, Sidorowicz A, Golebiowska J, Siemieniewski H, and Banas T. 1986. Comparative study of the structure of glyceraldehyde 3 phosphate dehydrogenase from bovine heart muscle. Comp. Biochem. Physiol. 85B ( 4 ) : 811 818. Levitzki A. 1974 Half of the sites and all of the sites reactivity of rabbit muscle glyceraldehyde 3 phosphate dehydrogenase. J. Mol. Biol. 90: 451 458. Maurer KH, Pfeiffer, F, Zehender H, and Mecke D. 1983. Characterization of two glyceraldehyde 3 phosphate dehydrogenase isoenzymes from the pentalenolactone producer Streptomyces arenae Journal of Bacteriology, 153 ( 2 ) : 930 936. McElwee JJ, Schuster E, Blanc E, Thornton J, and Gems D. associated metabolic traits reitera ted in long lived daf 2 mutants in the nematode Caenorhabditis elegans 472]. Mecha nisms of Ageing and Development 127: 922 936. McMurry J and Begley T. 2005. The Organic Chemistry of Biological Pathways. 1 st ed. Roberts and Company Publishers. Mendenhall AR, LaRue B, and Padilla PA 2006. Glyceraldehyde 3 phosphate dehydrogenase mediates anoxia response and survival in Caenorhabditis elegans Genetics 174: 1173 1187. Nagradova NK. 2001 Study of the propertie s of phosphorylating d glyceraldehyde 3 phosphate dehydr ogenase. Biochemistry (Moscow) 66 ( 10 ) : 1067 1076. Nakajima H, Amano W, Kubo T, Fukuhara A, Ihara H, Azuma YT, Tajima H, Inui T, Sawa A, and Takeuchi T. 2009 Glyceraldehyde 3 phosphate dehydrogena se aggregate formation participates in oxidative stress induced cell death. Journal of Biological Chemistry 284 ( 49 ) : 34331 34341. New England Biolabs. 2011 IMPACT kit instruction manual. Retrieved from: www.neb.com New England Biolabs. Accessed September 2011. Gene restriction enzyme map. Retrieved from: http://tools.neb.com/NEBcutter2/index.php Palamalai V and Miyagi M. 2010. Mechanism of glyceraldehyde 3 phosphate dehydrogenase inactivation by tyrosine nitration. Protein Science 19: 255 262. Pierce, SB, Costa M, Wisotzkey R Devadhar S, Homburger SA, Buchman AR, Ferguson KC, Heller J, Platt DM, Pasquinelli AA, Liu LX Doberstein SK, and Ruvkun G. (2001).

PAGE 84

74 Regulation of DAF 2 receptor signaling by human insulin and ins 1 a membe r of the unusually large and diverse C. elegans insulin gene family. Genes Dev. 15 ( 6 ) : 672 686. QIAGEN. 2006. QIA Miniprep Handbook, Second Edition. Ravichandran V, Seres T, Moriguchi T, Thomas JA, and Johnston Jr RB. 1994. S thiolation of glyceralde hyde 3 phosphate dehydrogenase induced by the phagocytosis associated respiratory burst in blood monocytes. The Journal of Biological Chemistry 269 ( 40 ) : 25010 25015. Rey nolds CH and Dalziel K. 1979. Factors affecting coenzyme binding and subunit intera ctions in glyceraldehyde 3 phosphate dehydrogenase. Biochimica et Biophysica Acta 567: 287 294. Riddle DL, Blumenthal T, Meyer BJ, and Priess JR. 1997. C. elegans II. Cold Spring Harbor Laboratory Press: Plainview, NY. Ruzanov P, Riddle DL, Marra MA, McK ay SJ, and Jones SM. 2007. Genes that may modulate longevity in C. elegans in both dauer larvae and long lived daf 2 ad ults. Experimental Gerontology 42: 825 839. Schuppe Koistinen I, Moldeus P, Bergman T, and Cotgreave IA. 1994. S thiolation of human endothelial cell glyceraldehyde 3 phosphate dehydrogenase after hydrogen peroxide treatment. Eur. J. Biochem 221: 1033 1037. Scott BA, Avidan MS, and Crowder CM. 2002. Regulation of hypoxic death in C. elegans by the insulin/IGF r eceptor homolog DAF 2 Science 296: 2388 2391. Sirover MA 1999. New insights into an old protein: the functional diversity of mammalian glyceraldehyde 3 phosphate dehydrogenase. Biochimica et Biophysica Acta 1432: 159 184. Sirover MA. 2005 New nuclear functions of the glycolytic protein, glyceraldehyde 3 phosphate dehydrogenase, in mammalian cells. Journal of Cellular Biochemi stry 95: 45 52. Sirover MA. 2011 On the functional diversity of glyceraldehyde 3 phosphate dehydrogenase: biochemical mechanisms and regulator y control. Biochimica et Biophysica Acta 1810: 741 751. Soukri A, Mougin A, Corbier C, Wonacott A, Branlant C, and Branlant G 1989. Role of the histidine 176 residue in glyceraldehyde 3 phosphate dehydrogenase as probed by site directed mutagenesis. Biochemistry 28 ( 6 ) : 2586 2592.

PAGE 85

75 Stallcup WB and Koshland Jr DE. 1973a. Half of the sites reactivity in the catalytic mechanism of yeast glyceraldehyde 3 phosphat e dehydrogenase. J. Mol. Biol. 80: 77 91. Stallcup WB and Koshland Jr DE 1973b. Half of t he sites reactivity and negative co operativity: the case of yeast glyceraldehyde 3 phosphate dehydrogenase. J. Mol. Biol. 80: 41 62. Veli ck SF and Udenfriend S. 1953 The composition and amino acid end groups of glyceraldehyde 3 phosphate dehydrogenase J. Biol. Chem. 203: 575 582. Velick SF, Hayes JE, and Harting J. 1953. The binding of diphosphopyridine nucleotide by glyceraldehyde 3 phosphate dehydrogenase. J. Biol. Chem. 203: 527 544. Walstrom K. 2012. Personal Communication. Weber H, Engelmann S, Becher D, and Hecker M. 2004. Oxidative stress triggers thiol oxidation in the glyceraldehyde 3 phosphate dehydrogenase of Staphylococcus aureus Molecular Microbiology 52 ( 1 ) : 133 140. Wikipedia. Accessed January 2012. Glycolysi s cycle. Retrieved from: http://en.wikipedia.org/wiki/Glycolysis Wormatlas. Accessed January 2012. Life cycle of C. elegans Retrieved from: http://www.wormatlas.org/ver1/handbook/anatomyintro/anatomyintro.htm Yarbr ough PO and Hecht RM. 1984 Two iso enzymes of glyceraldehyde 3 phosphate dehydrogenase in Caenorhabditis elegans The Journal of Biological Chemisry 259 ( 23 ) : 14711 14720. Yun M Park CG, Kim JY, and Park HW. 2000 Structural analysis of glyceraldehyde 3 phosphate dehydrogenase from Esch erichia coli : direct evidence of substrate binding and cofactor induced confor mational changes. Biochemistry 39: 10702 10710.

PAGE 86

76 Appendix A: Buffer recipes Bacteria Terrific Broth (1 L) 800 mL dH2O 12 g Bacto tryptone 24 g yeast extract 4 mL glycerol DI to 900 mL Dissolve and autoclave. Add 100 mL of autoclaved 0.17 M KH 2 PO 4 /0.72 M K 2 HPO 4 solution and mix. Luria Broth (500 mL) 12.5 g LB powder NP to 500 mL Dissolve and autoclave. Gel Electrophoresis 10 % Acrylamide Urea gel 3.15 g urea 1.88 mL 40 % acrylamide (acrylamide/bis acrylamide 37:1) 0.375 mL 20X SB NP to 7.5 mL Polymerize with 35 L 10% APS and 15 L TEMED. 2X Urea loading buffer 5 g urea 2 mL 5X TBE 2 3 mg bromphenol blue NP water to 10 mL. 10% acrylamide running gel 1.5 mL NP 3.0 mL 2X Run Gel buffer 1.5 mL 40% acrylamide (acrylamide/bis acrylamide 37:1)

PAGE 87

77 pipette 1 mL 0.1% SDS on top of gel. 5% acrylamide stacking gel 1.9 mL NP fer acrylamide 37:1) and 15 5X SDS Tank Buffer (500 mL) 7.58 g Tris base 36 g glycine 2.5 g SDS DI to 500 mL. Store in 4C. Dilute to 1X before use. 2X SDS PAGE Running Gel Buffer 0.75 M Tris HCl pH 8.8 0.2% SDS NP 4X SDS PAGE Stacking Gel Buffer 0.5 M Tris HCl pH 6.8 0.4% SDS NP 6X SDS PAGE Load Buffer (10 mL) 7 mL 4X Tris HCl/SDS pH 6.8 1 g SDS 3 mL glycerol 0.93 g DTT 1.2 mg Bromophenol blue S tore at 20 C. Coomassie stain (1L) 3 g Coomassie Brilliant B lue G 250

PAGE 88

78 20% methanol 10% acetic acid 70% DI IMPACT Purification Column Buffer 10 mL 1M Tris HCl pH 8 50 mL 5M NaCl 1 mL 0.5M EDTA NP to 500 mL Cell Lysis Buffer (25 mL) 1 mL 25X Protease Inhibitor (Roche) 20 Column buffer to 25 mL Cleavage buffer (10 mL) 0.5 mL 1M DTT Column buffer to 10 mL Elution buffer (20 mL) 1 mL 1M DTT Column buffer to 20 mL Western Blotting Western Transfer Buffer (3L) 600 mL 100% methanol 9.07 g Tris base 43.2 g Glycine DI to 3L Tris Buffered Saline/0.1% Tween 20 (TBST, 500 mL)

PAGE 89

79 5 mL 1M Tris pH 9.5 15 mL 5M NaCl H2O into an eppendorf, then drip Tween 20 to the 1 mL mark. Mix and pipette into Tris salt solution. Wash tube with NP and add to solution.) NP to 500 mL AP Development Solution (20 mL) 2 mL 1M Tris pH 9.5 0.4 mL 5M NaCl 0.5 mL 200 mM MgCl2 Just bef ore developing membrane 50 mg/mL 50 mg/mL BCIP to solution. Mix and pour on membrane. Agitate gently until color reaches desired intensity. Miscellaneous Kinetics Assay Buffer 2 mM NAD + 0.6 mM G3P 1 mM MgCl 2 1 mM Sodium phosphate buffer 0.5 M pH 7 5 mM DTT 50 mM Tris pH 8.5 D ialysis Buffer (1L) 30% glycerol 1mM DTT 10 mM Tris pH 7.6 1 mM EDTA NP Plasmid Prep. Cell Lysis Buffer 1% (w/v) SDS 0.2 M NaOH NP

PAGE 90

80 GTE Resuspension Buffer 25 mM Tris pH 8.0 50 mM glucose 10 mM EDTA Gel Elution Buffer 0.3 M NaOAc pH 5.2 0.1 % SDS 1 mM E DTA NP water Filter sterilize the final solution before use.

PAGE 91

81 Appendix B: Sequencing results The sequencing information is given in two parts. The first part shows that the gpd 3 gene is in frame with the intein protein. The second part shows that the gpd 3 gene matches the wormbase protein sequence. Part of figure 2.1 is reproduced here to compare with the sequencing results. GGA TCC CAG GTT GTT GTA CAG AAC AGA AGA GCT ATG AC C AAG CCA AGT Intein -----------------------------SapI ---gpd 3 Start codon >>>QUERY, 1026 nt vs TMP.q2 library >>QUERY (1028 nt) Waterman Eggert score: 5130; 311.9 bits; E(1) < 1.4e 88 100.0% identity (100.0% similar) in 1026 nt overlap (1 1026:1 1026) Sequenced using LALIGN ( http://fasta.bioch.virginia.edu/fasta_www2/fasta_www.cgi?rm=lalign ) 10 20 30 40 50 60 gpd 3 ATGACCAA GCCAAGTGTCGGAATCAACGGATTCGGAAGAATCGGACGTCTTGTCCTCCGC :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid ATGACCAAGCCAAGTGTCGGAATCAACGGATTCGGAAGAATCGGACGTCTTGTCCTCCGC 10 20 30 40 50 60 70 80 90 100 110 120 gpd 3 GCCGCTGTCGAGAAGGACAGTGTCAATGTTGTTGCCGTCAACGATCCATTCATCTCCATC :::::::::::::::::::::::::::::::::::::::::: :::::::::::::::::: Plasmid GCCGCTGTCGAGAAGGACAGTGTCAATGTTGTTGCCGTCAACGATCCATTCATCTCCATC 70 80 90 100 110 120 130 140 150 160 170 180 gpd 3 GACTACATGGTCTACTTGTTCCA GTACGATTCCACTCACGGACGCTTCAAGGGAACCGTT

PAGE 92

82 :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid GACTACATGGTCTACTTGTTCCAGTACGATTCCACTCACGGACGCTTCAAGGGAACCGTT 130 140 150 160 170 180 190 200 210 220 230 240 gpd 3 GCCCACGAGGGAGACTACCTTCTTGTCGCCAAGGAAGGAAAGTCCCAGCACAAGATCAAG :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid GCCCACGAGGGAGACTACCTTCTTGTCGCCAAGGAAGGAAAGTCCCAGCACAA GATCAAG 190 200 210 220 230 240 250 260 270 280 290 300 gpd 3 GTCTACAACTCAAGAGACCCAGCTGAGATCCAATGGGGAGCCTCTGGAGCCGACTATGTC :::::::::::::::::::::::::::::::::: :::::::::::::::::::::::::: Plasmid GTCTACAACTCAAGAGACCCAGCTGAGATCCAATGGGGAGCCTCTGGAGCCGACTATGTC 250 260 270 280 290 300 310 320 330 340 350 360 gpd 3 GTTGAGTCCACCGGAGTCTTCACCACCATCGAGAAGGCCAATGCTCACTTGAAGGGAGGA :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid GTTGAGTCCACCGGAGTCTTCACCACCATCGAGAAGGCCAATGCTCACTTGAAGGGAGGA 310 320 330 340 35 0 360 370 380 390 400 410 420 gpd 3 GCCAAGAAGGTCATCATCTCTGCTCCATCTGCTGATGCTCCAATGTTCGTCGTCGGAGTC :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid GCCAAGAAGGTCATCATCTCTGCTCCATC TGCTGATGCTCCAATGTTCGTCGTCGGAGTC 370 380 390 400 410 420 430 440 450 460 470 480 gpd 3 AACCACGAGAAGTACGATCATGCCAACGACCACATCATCTCCAATGCTTCCTGCACCACT :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid AACCACGAGAAGTACGATCATGCCAACGACCACATCATCTCCAATGCTTCCTGCACCACT 430 440 450 460 470 480 490 500 510 520 53 0 540 gpd 3 AACTGCCTTGCTCCACTTGCCAAGGTCATCAATGACAACTTCGGAATTATTGAGGGACTT :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid AACTGCCTTGCTCCACTTGCCAAGGTCATCAATGACAACTTCGGAATTATTGAGGGACTT 490 500 510 520 530 540 550 560 570 580 590 600 gpd 3 ATGACCACTGTCCACGCCGTCACCGCCACCCAAAAGACTGTTGACGGACCATCAGGAAAG :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid ATGACCACTGTCCACGCCGTCACCGCCACCCAAAAGACTGTTGACGGACCATCAGGAAAG 550 560 570 580 590 600 610 620 630 640 650 660 gpd 3 CTCTGGAGAGACGGACGTGGAGCTGGACAAAACATCATCCCAGCCTCTA CTGGAGCCGCT :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid CTCTGGAGAGACGGACGTGGAGCTGGACAAAACATCATCCCAGCCTCTACTGGAGCCGCT 610 620 630 640 650 660 670 680 690 700 710 720 gpd 3 AAGGCTGTCGGCAAGGTTATCCCAGAGCTCAATGGAAAGCTCACCGGAATGGCTTTCCGT :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid AAGGCTGTCGGCAAGGTTATCCCAGAGCTCAATGGAAAGCTCACCGGAATGGCTTTCCGT 670 680 690 700 710 720

PAGE 93

83 730 740 750 760 770 780 gpd 3 GTCCCAACCCCAGATGTCTCTGTTGTTGATCTCACTGCTCGTCTTGAGAAGCCAGCTTCC :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid GTCCC A ACCCCAGATGTCTCTGTTGTTGATCTCACTGCTCGTCTTGAGAAGCCAGCTTCC 730 740 750 760 770 780 790 800 810 820 830 840 gpd 3 CTCGATGACATTAAGAAGGTTATCAAGGCTGCCGCTGACGGACCAATGAAGGGAATTCTC :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid CTCGATGACATTAAGAAGGTTATCAAGGCTGCCGCTGACGGACCAATGAAGGGAATTCTC 790 800 810 820 830 840 850 860 870 880 890 900 gpd 3 GCTTACACCGAGGATCAAGTTGTCTCCACTGACTTTGTCTCCGATACCAACTCTTCCATC :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid GCTTACACCGAGGATCAAGTTGTCTCCACT GACTTTGTCTCCGATACCAACTCTTCCATC 850 860 870 880 890 900 910 920 930 940 950 960 gpd 3 TTCGATGCCGGAGCATCCATCTCACTCAACCCACACTTTGTCAAGCTCGTCTCATGGTAC ::::::::::: ::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid TTCGATGCCGGAGCATCCATCTCACTCAACCCACACTTTGTCAAGCTCGTCTCATGGTAC 910 920 930 940 950 960 970 980 990 1000 1010 1020 gpd 3 GATAACGAGTTCGGATACTCCAACAGAGTCGTCGACCTTATCTCCTACATTGCTACCAAG :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: Plasmid GATAACGAGTTCGGATACTCCAACAGAGTCGTCGACCTTATCTCCTACATTGCTACCAAG 970 980 990 1000 1010 1020 gpd 3 GCCTAA :::::: Plasmid GCCTAA

PAGE 94

84 Appendix C : Kinetics results The kinetics data are presented below in table format. The first table lists the data points for figure 3.15, and the second table lists the data points for figure 3.16. G3P conc entration (mM) Rate (moles/minute) 0.02 0.035 0.02 0.064 0.02 0.087 0.05 0.273 0.05 0.402 0.05 0.241 0.10 0.772 0.10 0.868 0.10 0.836 0.15 1.190 0.15 1.238 0.15 1.238 0.30 2.090 0.30 2.090 0.30 1.849 0.60 2.894 0.60 2.476 0.60 2.412 0.60 2.668 0.60 2.443 1.50 3.505 1.50 2.958 1.50 2.974 NAD + conc entration (mM) R ate (moles/minute) 0.10 0.418 0.10 0.450 0.10 0.547 0.50 1.961 0.50 1.994 0.50 1.704 2.00 2.669 2.00 2.444 2.00 2.893 2.00 2.475 2.00 2.411

PAGE 95

85 10.00 4.984 10.00 4.984 10.00 3.826