Systems Biology

PAGE 1

SY STEMS BIOLOGY: THE SEARCH FOR MICRO RNA REGULATION OF HUMAN CILIARY LUNG CELLS BY NAOMI LOUISE PAULA ARDJOMAND KERMANI A Thesis Submitted to the Division of Natural Sciences New College of Florida in partial fulfillment of the requirements for the degree Bachelor of Arts Under the sponsorship of Dr. Sandra Gilchrist Sarasota, Florida April, 2009

PAGE 2

ii DEDICATIONS unconditional love and support throughout the cou forever baby brother and sis to choose the both of you.

PAGE 3

iii Preface In the spring semester of 2006, while hunting for available research positions, my advisor, Dr. Sandra Gilchrist, presented me with th e opportunity of interning at Lovelace Respiratory Research Institute (LRRI) in Albuquerque, NM. Dr. Gilchrist had been of Florida in 1972, and discussed the possibility of an undergraduate research program at the institute. Being that I was raised in New Mexico and knew the institute well due to happy to take advantage of the opportunity After speaking in great length with Dr. Rubin, we decided that interning in the infectious disease department would be the best fit for my interests. The summer of that same year I traveled to New Mexico, pioneering the Lovelace New College partnership for a month and a half long internship at the institute. I was only expected to shadow multiple scientists and graduate students, ask questions and seek answers, no set guidelines to be met and no projects to be explored. I grew impatient with gaining so little hands on experience that I sought the guidance of the involvement in a project of some kind would greatly benefit my internship experience, and I began working with D r. Juanita Martinez in the newly emerging field of bioinformatics. I was given the simple, though laborious, task of computational predictions in

PAGE 4

iv earlier than predicted. With my newly available time on my hands, I began reading my own hypotheses. Determined to prove undergraduate students capabilities in research, I presented a paper d etailing my hypothesis, supported with peer reviewed evidence, to Dr. Rubin. My motivation and willingness to learn was clearly demonstrated and it was that paper that resulted in LRRI asking me to come back to the institute to perform research for my the sis. In the summer of 2007, I traveled back to LRRI with two additional New College students in tow, all ready to prove our worth in advanced scientific research. I continued to work in the Infectious Disease department under the supervision of Dr. Marti nez and Dr. Harrod and began the quest for my thesis topic. Knowing that I wanted to continue in bioinformatics, Dr. Martinez presented me with a peer reviewed article that listed 37 human lung ciliary genes and I was instructed to determine if any of the genes contained microRNA targeting sites. We discussed various miRNA computational tools, and information on target motif location, but beyond that no further instruction, information, or details were given; it was clear to me that I was on my own from t hat point forward. Having no idea what microRNAs are or how to find their targeting sites on a gene, I began reading anything that I could get my hands on, slowly but surely educating myself on all aspects of miRNAs. After exploring algorithms, computer software, and websites dedicated to finding miRNA targeting sites I finally settled on one, TargetScan. friendly interface, combined with the most up to date miRNA

PAGE 5

v I b egan by inputting the gene name or accession number in to TargetScan in order to find which genes had miRNA target sites, noting alternate gene names and the number of miRNAs that targeted the gene, if any. Omitting genes without miRNA target sites, I end ed up with 33 genes with anywhere from 1 500 miRNAs potentially targeting a single gene. It was then clear that further specifications were needed to condense the number of miRNAs with target sites to a more manageable size. By reading literature regardi ng TargetScan I was able to conclude that genes with a context percent score below 50% could be omitted from my study as it meant that the miRNA target site on a gene was not as favorable (highly conserved) as those scoring above 50%. Genes with 8 mer miR NA seed matches would be ideal, but that genes with7mer m8 miRNA seed matches should also be considered and decided on a new context percent score of 75%. By doing this I ended up with 6 miRNAs that collectively potentially targeted 3 genes of the ciliary axoneme. I then met with Dr. Harrod and Dr. Martinez to discuss my results and to request approval to continue my research as I hypothesized that these miRNAs could possibly coincide with the formation of new cilia. Under the guidance of Dr. Martinez I was then able to take my computationally derived results into the lab, in an attempt to validate my data experimentally. My desire to figure out if the 6 candidate miRNAs were up regulated or down regulated during ciliogenesis quickly became the driving f orce for my research and eventually became the subject of my thesis. This thesis is divided into two major sections; a brief literature review to place the thesis into context as well as a section on the specific experimental work that was done at Lovelac e Respiratory Research Institute.

PAGE 6

vi TABLE OF CONTENTS PAGE PART I. LITERATURE REVIEW PART II. EXPERIMENTAL WORK INTRODUCTION MicroRNAs METHODS Quantitative Real RESULTS Computational Prediction of miRNAs Invol Detection of miRNAs in Undifferentiated Human Epithelial Cells QRT APPENDIX I. ADDITIONAL INFORMATION ON I II REFERENCES

PAGE 7

vii ACKNOWLEDGMENTS I would like to express profound gratitude to my advisor, Dr. Sandra Gilchrist, for her invaluable support, encouragement, supervision an d useful suggestions throughout this research work. I am also highly thankful to Dr. Robert Rubin, President of Lovelace Infectious Disease, for allowing me the privilege of wo I am as ever, especially indebted to my parents; Mr. Iradj Ardjomand Kermani and Ms. Dorinda Ardjomand Kermani for their never ending love and support throughout my life. Moreover, my sincere thanks go to my friends at LRR I, who shared their love of research and experiences with me. Finally, I wish to express my heartfelt appreciation to Dr. Juanita Martinez, Associate Research Scientist at Lovelace Respiratory Research Institute, who guided me about the direction of my th esis from the beginning Her moral support and continuous guidance enabled me to complete my work successfully. To each of the above, I extend my deepest appreciation and gratitude. Naomi Ardjomand Kermani

PAGE 8

viii LIST OF FIGURES PAGE 1. MicroRNA seed ma 5. RNA 6000 Nano Ladder of ALI RNA 6. Preparation for QRT PCR assays 7. Quantimir RT Kit Protocol 11. 12a. miR 12b. miR 13a. miR 13b. miR 14a. miR 14b. miR A II

PAGE 9

ix LIST OF TABLES PAGE 1. Technological advances in genet 6. Examples of up A I

PAGE 10

x ABSTRACT MicroRNAs (miRNAs) are short (~22nt), endogenous, non coding RNAs that play an important gene r egulatory role in animals and plants by targeting mRNAs for degradation or translational repression. Mucociliary clearance is an essential mechanism of lung defense against inhaled chemical particulate to xins and infectious organisms. Ciliated cells are among several differentiated cell types within the lung epithelium. To maintain normal mucociliary clearance, ciliogenesis is essential. Through computational data mining the expression of miRNAs during ciliogenesis was investigated and found 6 miRNAs (m iR 15a, miR 15b, miR 16, miR 195, miR 424, miR 497) with targeting sites on 3 genes (GHR, TUBA1A, CGI 38) of the ciliary axoneme of the human lung. Experimental validation revealed that the expression of the 6 miRNAs did indeed coincide with ciliogenesis b eing down regulated during cell differentiation. ____________________________ Dr. Sandra Gilchrist Division of Natural Sciences

PAGE 11

1 Literature Review such as flies emerging from rotting flesh. It was in 1864 that Louis Pasteur refuted this belief system by a simple experiment that exposed sterile broth, contained within either a straight neck or swan neck flask, to the surrounding air. Life. Never will the doctrine of spontaneous generation recover from the mortal blow of (Vallery Radot 1901, vol. 1, p. 142) ments provided evidence for a new theory that all life must arise from pre interest of an Augustinian monk, Gregor Mendel, in 1865, who experimented with cross breeding pea plants to understand how heredity in offspring was influenced by individual pioneered European the study of genetics as we know it and advances in the field of geneti cs are now constant and ever growing. Once the three dimensional chemical structure of deoxyribonucleic acid (DNA) was elucidated (Watson & Crick, 1953) the importance of learning the information stored within this macromolecule became a priority. Each in dividual gene corresponds to a particular segment of DNA so, in theory, DNA is a storage unit filled with the sum of genetic information that an organism inherits from each of its parents at the moment of fertilization. Knowing this, scientists began stud the breadth of genetic information stored within, in order to formulate genomes unique to

PAGE 12

2 each individual organism. Table 1 illustrates the fairly recent advances scientists have made in the field of genetics. 1969 Ciliogenesis of primary cilia of cells lines studied in vitro (Wheatley, 1969) 1972 First recombinant DNA molecules are produced (Jackson et al., 1972) 1973 DNA Electrophoresis using EtBr & Agarose Gels (Sharp et al, 1973) 1977 Chain termination method for DNA Sequencing Developed (Sanger, 1977); First genetic engineering company, Genentech, is founded 1981 Discovery of human oncogenes 1986 Polymerase Chain Reaction (PCR) described as most sensitive DNA assay (Mullis, 1986) 1988 Human Genome Project founded by NIH and DOE 1989 DNA fingerprinting technique described (Hillel et al, 1989) 1991 Use of Expressed Sequence Tags (ESTs) begins (Adams et al., 1991) 1993 Genetically modified tomatoes are first GMO available to public; microRNA discovered in C elegans (Lee et al 1993) 1995 Haemophilus i nfluenzae Rd is first free living organism with completely sequenced genome ( Fleishmann 1995) 1996 Saccharomyces c erevisiae genome is sequenced 1998 C. e legans is first multi cellular organism to have genome sequenced; RNAi described (Fire et al 1998) 1999 Drosophila genome is sequenced and is found to contain 177 genes closely related to human genes; Comparative Genomics is realized 2000 Human genome is sequenced; Discovery of approximately 30,000 human ge nes 2002 Mouse genome is sequenced and is found to contain 700 genes also found in the human genome in approximately the same order; Novel components of human cilia are identified; miRNA reported in plants (Reinhart et al., 2002) 2004 Rough draft of ra t genome is sequenced 2007 Research suggests defects of renal cilium lead to Polycystic Kidney Disease characterization. (Yoder, 2007) 2008 Research suggests miRNAs play important role in underlying pathways of PKD (Chu & Friedman, 2008) Table 1. Techn ological advances in genetics. Selected t echnological advances in the field of genetics over the last three decades. Sequencing the human genome has revealed 20,000 25,000 protein coding genes stored on 23 chromosomal pairs; 22 autosomal chromosome pair s plus a 23rd sex determining X and Y chromosome pair (Lander et al., 2001). In addition to protein coding genes within the human genome, there are thousands of ribonucleic acid (RNA)

PAGE 13

3 encoding genes, although the exact number is yet to be determined. Ar med with this information, geneticists have the ability to study genetic disorders via gene expression, the process of a gene product, proteins or RNAs, being produced from a DNA sequence of inheritable information extrapolated from a gene. Similar to DNA RNA is a single stranded structure containing ribose that is synthesized through a process called transcription using DNA as a template. There are many different types of RNAs involved in translation and RNA processing as well as regulatory RNAs involve d in RNA interference (RNAi), such as double stranded small interfering RNAs (siRNAs) and single stranded microRNAs ( Peculis et al. 1993; Shen et al., 2008). MicroRNAs (miRNAs) are endogenous RNAs approximately 22 nucleotides (nt) in length that direct p osttranscriptional repression of messenger RNAs (mRNAs) by pairing to protein coding gene messages (Bartel, 2004). To understand miRNAs recognition of their target messages and how they function, it is important to understand why many genetic messages dec rease upon miRNA expression and increase upon miRNA knockdown Upregulated and downregulated messages have matches to the miRNA seed sequence, base positions 2 codon and polyadenylation signal of the gene. It is for this reason that it is important to understand how to interpret miRNA targeting sites according to their seed matches (Krutzfeldtet al., 2005; Lim et al., 2005; Giraldez et al., 2006; Rodriguez et al., 2007) Using the conserved Watson Crick pair miRNA, which includes the miRNA seed, scientists are able to predict miRNA targeting sites (Lewis et al,. 2003, 2005; Brennecke et al., 2005; Krek et al., 2005). There are four major types of miRNA targeting sites; 6mer, 7mer m8, 7mer A1, and 8mer. The 6mer

PAGE 14

4 miRNA targeting site is a perfect 6 nucleotide match to the miRNA seed (Lewis et al., 2005). The 7mer m8 miRNA targeting site is an exact match to the miRNA seed along with a match to nucleotide position 8 (Lewi s et al., 2003, 2005; Brennecke et al., 2005; Krek et al., 2005). The 7mer A1 miRNA targeting site is an exact match to the miRNA (Lewis et al., 2005). The 8mer miRNA targeti ng site is an exact match of the miRNA, nucleotide positions 2 of the miRNA (Figure 1) (Lewis et al., 2005). Figure 1 MicroRNA seed matches. The four major types of miRNA targeting site se ed matches: 6 mer, 7mer m8, 7mer A1, and 8mer

PAGE 15

5 Seed pairing is important in recognizing miRNA targeting sites; however it is only one determinant in miRNA targeting specificity in mammals and does not necessarily indicate repression of miRNAs if seed pai ring is not 7mer m8 or 8mer (Doench & Sharp, 2004; Brennecke et al., 2005; Lai et al., 2005) Sites of conservation for miRNA families in orthologous untranslated regions (UTRs) of genes, conserved within human, mouse, rat, and dog genomes assist in ident ifying miRNA targeting pairing (Farh et al., 2005; Krek et al., 2005; Krutzfeldt et al., 2005; Lewis et al., 2005; Giraldez et al., 2006) Therefore, it would be ideal t o study one of the most highly conserved cellular structures, cilia, as a model for studying miRNAs and their targeting specificity in mammals. Cilia and flagella are motile organelles with hair like structures that project from the surface of several type s of eukaryotic cells and are essentially identical in internal structure (Figure 2). Externally, flagella are longer with a whip like tail and are found singularly or in pairs while cilia are shorter structures and are found in clusters. Figure 2. Int ernal structure of cilia and flagella. Graphic representation of a cross section of cilium and flagellum, demonstrating identical internal structures.

PAGE 16

6 Both consist of a cylindrical array of nine filaments and a pair of single microtubules running through the center of the bundle, producing a 9+2 arrangement (Costello, 1973). Flagella are extracellular and are usually found singularly with a variety of cell specific wave like beating patterns, one example being sperm. On the other hand cilia, excluding si ngle non motile primary cilium, are found in clusters on a mammals, motile cilia are found in the fallopian tubes, moving the ovum from the ovary and into the ute rus. In all mammals, motile cilia are found in mucociliary cells in the lung epithelium, moving debris up the airway and out of the lungs (Ross et al., 2007). In addition to cell motility, cilia are involved in cilium based signaling in which signals are transmitted to the nucleus and cytoplasm of a cell in order to control gene expression however the manner in which this function is performed is still unknown (French et al., 2005). Important historical landmarks in cilia research are shown in Table 2. Ciliogenesis, or the formation of cilia, occurs in eukaryotic cells and is sequentially coupled with mitosis in early development (Kirk, 1998). All ciliated cells lose their cilia by one of two mechanisms; resorption, in which the cilium is retracted into the cell prior to cell division or deciliation, the process in which cilia is shed from a cell due to exposure to stimuli (Mahjoub et al., 2002). Sea urchin embryo development is a model system to explore ciliogenesis as ciliogenesis is the first morphog enetic event that a sea urchin embryo will undergo. Prior to hatching, a sea urchin embryo will produce its first structure, subsequent to telophase, by growing a single cilium, creating a 9+2 axoneme on each blastomere (Lepage & Gache, 1990). The proces s of deciliation triggers the re synthesis of tubulin and dynein, the 9+2 ciliary primary components which

PAGE 17

7 pre exist in great amounts within the embryo, thereby replenishing large pools of these axonemal building blocks. As a result the embryo is required to synthesize diminutive amounts of tubulin and dynein for expedient assemblage of cilia, thus avoiding disruption of de novo ciliogenesis (Auclair & Siegel, 1966; Raff et al., 1971; Stephens, 1977). This efficient system of de novo ciliogenesis and rege neration of lost cilia serves as a subroutine during the process of development in order to avoid disruption of major routines of embryonic development amidst the constant regeneration of cilia (Stephens, 1994). In addition to ciliogenesis, microRNA post transcriptional gene silencing is important in embryonic development as well, playing a critical role in intercellular coordination (Levine et al., 2007). The connection between microRNA and mammalian ciliary cells in the kidneys (Chu & Friedman, 2008) a nd in the female oviduct (Carletti & Christenson, 2008) have been widely experimentally studied, however their relationship within mucociliary cells of airway epithelial cells is still relatively unexplored. Airway epithelial cells are critical in defense against pathogens inhaled and maintain the channel of airflow to and from the alveoli with the mutual function of ciliary cells providing mucociliary clearance in the lungs (Thompson et al., 1995; Knight & Holgate, 2003; LeSimple et al., 2006). As well a s the major defense roles that airway epithelial cells and mucociliary cells play, these cells are central in the pathogenesis of major lung diseases such as asthma, chronic obstructive pulmonary disease (COPD), and bronchogenic carcinoma (Thompson et al., 1995; Puchelle et al., 2006). It is the search for microRNA regulation of human lung ciliated genes, specifically airway epithelial cells, that is the focus of exploration in this thesis.

PAGE 18

8 Year Landmark in Cilia Research 1675 Living protozoan with flat b elly and thin feet was observed by Leeuwenhoek. (Translated by Dobell, 1958) 1786 1835 Ciliary movement in amphibia is studied; Cilia of the mammalian oviduct is described; First definitive treatises on cil Valentin, 1835) 1909 Cilia shown to consist of a number of filaments (Dellinger, 1909) 1927 Fixation of the metachronal wave is invented (Gelei, 1927) 1928 Compiled evidence shows that cilia are active organelles in thems elves (Gray, 1928) 1930 Microphotographs of the phases of a single ciliary beat are published (Gray, 1930) 1952 First electron micrographs of cilia confirm that cilia is composed of fibrils (Manton, 1952; Manton & Clarke, 1952) 1954 9+2 Arrangement is d emonstrated t o be universal for motile cilia. (Fawcett & Porter, 1954) 1955 Microphotography with sea urchin spermatozoan (Gray, 1955) ; Hydrodynamic theory to explain spermatozoan propulsion i s developed. (Gray & Hancock, 1955) 1961 Definitive proof of activity in isolated cilium (Brokaw, 1961) 1965 Bends along 9+2 sea urchin axoneme are shown to be circular arcs (Brokaw, 1965); Cilia in different positions shown to consistently have different tip patterns (Satir, 1965); Description and naming of Dynei n (Gibbons & Rowe, 1965) 1976 Screening of human mutants leads to an health (Afzelius, 1976) Table 2. I mportant historical landmarks in cilia research. Cilia was first observed in 1675 by Antony Van Leeuwenhoek w hich led to extensive study of the organelle.

PAGE 19

9 Systems Biology: The Search for MicroRNA Regulation of Lung Ciliated Genes INTRODUCTION Cilia in the Lung Mucociliary clearance is an essential mechanism of lung defense against inhaled chemical particulat e toxins and infectious organisms. Ciliated cells are among several differentiated cell types within the lung epithelium. Multiple cells work in concert to provide a regularly beating ciliary ladder that moves debris mixed with mucus and periciliary fluid up the airway. Defects in lung cilia can be due to genetics as with primary cilia dyskinesia ( PCD), resulting in non motile cilia. In mammals, non motile cilia results in four manifestations: failure of embryonic turning resulting in early embryonic dea th, reproductive sterility, abnormal ciliary beating resulting in hydrocephalus, and respiratory dysfunction (Badano et al., 2006). Cilia dysfunction is associated with bronchitis, rhinitis, sinusitis and otitis (Afzelius, 2004) and can lead to chronic in fections. Multiple human diseases incl uding Bardet Biedl syndrome, poly cystic kidney disease and retinal degeneration are all associated with defective cilia ( Katsanis et al. 200 1 ; Praetorius & Spring, 2001; Grimm et al., 2003; Nauli et al., 2003; Praetorius & Spring, 2003; Liu et al., 2005; Low et al., 2006; Shillingford et al., 2006). Cilia structures are found on a wide variety of eukaryotic cells. They are located throughout the body and are among the most highly conserved cellular structures from single celled organisms ( Chlamydomonas ) to human (Pazour et al., 2005). A proteomics

PAGE 20

10 study described the human cilia axoneme to be composed of over 210 proteins (Ostrowski, 2002) while in early work it is estimated that there are over 250 proteins in the blue green algae model, Chlamydomonas ( Dutcher et al. 1984). The transcription factor, FoxJ1, is considered the quintessential marker of ciliated cells in human lung; FoxJ1 appea rs in air liquid interface cultures around 2 days after being exposed to air (Look et al., 2001). In early evolution, cilia provided unicellular organisms motility in water and as plants adapted to non aquatic life, the organelle faced almost complete elimination with the exception of gamete transport of protozoans belonging to the phylum Ciliophora However, within tissue or organs of complex multi cellular animals. Cilia play a vita l role in many biological processes, including cerebrospinal fluid flow, renal physiology, sensory reception, and mucociliary clearance (Ibaez et al., 2003). MicroRNAs MicroRNAs (miRNAs) are short (~22nt), endogenous, non coding RNAs that play an importan t gene regulatory role in animals and plants by targeting mRNAs for degradation or translational repression. Almost all plant miRNAs regulate their targets by directing mRNA cleavage at single sites within the coding regions. In contrast, animal miRNAs rep ress gene expression by mediating translational attenuation, a mechanism of regulating levels of transcription by interfering with mRNA elongation to allow for the formation of a secondary RNA structure, through (multiple) miRNA binding sites located withi n the 3' untranslated region (UTR) of the target gene. Some miRNAs are encoded

PAGE 21

11 by genes located in regions of the genome distant from other coding regions, implying that they derive from independent transcription units (Lagos Quintana et al., 2001; Lau et al., 2001; Lee et al., 2001). MicroRNAs were first discovered in mutants of the nematode Caenorhabditis elegans that lacked the ability to control the timing of specific cell fate switches during development (Bartel, 2004; He et al., 2004). There is evid ence indicating that miRNAs are important in many human diseases, including cancers (Ambros, 2003; Poy et al., 2004; Vella et al., 2004; He et al., 2005; Lu, 2005). There are presently thousands of miRNAs from invertebrates ( C. elegans Drosophila melanoga ster ), plants, and mammals that have been identified through computational and cloning approaches (Ambros, 2003; Ambros, 2004; Saini et al., 2007) In animal cells, microRNAs are expressed in the nucleus as parts of long primary miRNA (pri miRNA) transcrip A tails. A hairpin like precursor miRNA (pre miRNA) forms around the miRNA sequence of the pri miRNA and acts as a signal for digestion by Drosha, the double stranded (ds) ribonuclease, to produce the pre mi RNA (Lee, 2003). Exportin 5, a dsRNA binding protein, then mediates nuclear export of pre miRNAs (Yi, 2003). Dicer, a cytoplasmic dsRNA nuclease, then cleaves the pre miRNA into two single stranded molecules (Lee, 2002). The coding strand of one of the sin gle stranded mature miRNA associates with the RNA Induced Silencing Complex (RiSC). The resulting miRNA/RiSC represses protein mRNAs using short 7 quences of the single stranded miRNA, leaving 1 4 nucleotide (nt) overhangs on the miRNA (Figure 3 ) ( Khvorova et al., 2003; Matranga et al., 2005).

PAGE 22

12 sites for multiple miRNAs; this cooperative action makes inhibition more efficient (Doench et al., 2003; Lin et al., 2003). The same miRNA can also inhibit multiple target mRNAs; enabling it to regulate many genes in a pathway of a physiological process simultaneously (Lee, 2003). Figure 3. MicroRNA processing pathway From pri miRNA in the nucleus to mature miRNA in the cytoplasm. (Ambion, Applied Biosystems; Foster City, CA ) Cleavage of the target mRNA, translational inhibition, and mRNA deadenylation, are all actions of miR NAs (Chen, 2004). The exact mechanism of translational inhibition is still undefined, but it is suspected to be the result of the miRNA induced silencing complexes (miRISC) inhibiting translation by binding imperfectly matched sequences in l., 2004; Chu et al., 2006;

PAGE 23

13 Giraldez et al., 2006; Wu et al., 2006) MiRNAs are typically not fully complementary to the mRNA target although miRNA must have a specific sequence that recognizes the target mRNA; allowing for a single miRNA to bind to potent ially many targets (Hutvagner et al., 2002). This thesis describes a systems biology approach to search for miRNAs that may be involved in regulating (repressing) ciliogenesis in human lung epithelial cells. A genome wide computational search performed for miRNAs that would be predicted to target 37 ciliary gene transcripts that encode proteins of the cilia axoneme (Xiao, 2006) was conducted by use of the application TargetScan 4.0 (www.Targetscan.org). Genes with conserved miRNA target sites scoring above a 75th percentile are reported here. Three genes; GHR CGI 38 and TUBA1A contained highly conserved miRNA target sites for one or more of six miRNAs; miR 16, miR 15a, miR 15b, miR 195, miR 424, miR 497. To validate our computational predictions experimen tally, a hypothesis was formed to ask whether the six miRNAs are expressed in human epithelial cells, and if their expression coincides with ciliogenesis. Quantitative real time PCR was used to detect the expression product of all six miRNAs in differentia ting human epithelial cells purchased from Cambrex/Lonza (Walkersville, MD; University of Miami, FL). These results showed that the expression of all six miRNAs decrease during the course of time until the cells complete differentiation at 28 days, consist ent with the hypothesis that miRNAs are repressors of ciliary genes.

PAGE 24

14 MATERIALS & METHODS Computational Prediction of miRNA Regulation Thirty seven genes of the ciliary axoneme of the human lung were identified by Ross and colleagues to have increased mRNA levels over 28 days of differentiation in air liquid interface cultures (Ross et al 2007). Fifteen databases were used in a trial to test one of the ciliary genes to decide which of the databases were the most up to date with respect to miRNA registry. T his was done by inputting the accession number or name of each ciliary gene into each database and reviewing the outcome based on number of miRNA within the database. TargetScan 4.0 was chosen to search for miRNAs that target the 37 ciliary genes describe d by Ross and colleagues (Table 3) (Appendix I) (Ross et al 2007). Each gene was queried with TargetScan; in the event that the gene was not recognized by TargetScan, UCSC Genome Browser ( http://genome.ucsc.edu/ ) was used to search for alias gene names. Fi ve genes had multiple names found that were then entered in to TargetScan while one gene, KPL2 (AK 026817), could not be found in miRB ase and was omitted from the study.

PAGE 25

15 Gene Name Accession Number Gene Name Accession Number DNAI1 NM_012144 CGI 38 NM_016140 DNAI2 NM_023036 C6ORF97 NM_025059 EFHC1 NM_018100 CLUAP1 NM_024793 TTC30A F LJ13946 NM_152275 DNALI1 IDLC NM_003462 IFT57 NM_018010_1 EFHC2 NM_025184 IFT81 NM_014055 LRRC23 NM_006992 IFT88 NM_006531 NME5 NM_003551 FLJ23577 NM_144722 RIB C2 NM_015653 KPL2 AK026817 ROPN1 NM_031916 MNS1 NM_018365 SPAG6 NM_012443 MLF1 NM_022443 AY848702 CAPS NM_004058 RABL5 NM_022777 CETN2 NM_004344 SPA17 SP17 NM_017425 DYDC1 DPY30 AK125908 TEKT2 NM_014466 C10ORF63 NM_145010 TUBA1A TUBA3 NM_006009 DNA H9 Dynien NM_001372 TUBA4 NM_025019 NM_006000 RTDR1 RTD NM_014433 GHR NM_000163 TUBB2C NM_006088 HSPA1A NM_005345 ZMYND12 NM_032257 RABL4 NM_006860 IQCE NM_152558 Table 3. Ciliary gene list. Thirty seven genes of the ciliary axoneme of the human lung identified to have increased mRNA levels over 28 days of differentiation in air liquid interface cultures (Ross et al 2007). Cell Culture One vial of human bronchial epithelial cells from Cambrex/Lonza (Walkersville, MD; Miami, FL) was split and grow n in two collagen coated 100mL dishes in 25 mL of BEGM (Bronchial Epithelial Growth M edium) Media were changed every other day until cells reached confluency (7 10 days). The cells were then expanded 1:4 and distributed to 8 new 100mL dishes until 60 80% confluency. Cells were then transferred to 12 well plates with collagen coated transwell inserts and grown in 1:1 DMEM

PAGE 26

16 (Dulbecco's Modified Eagle's Medium) and BEBM (Bronchial Epithelial cell Basal Medium) without antibiotic at approximately 5x 10 5 cells p er well. Every other day the apical surfaces of the cells were washed and the medium was changed. Once cells reached confluency (4 7 days) the medium from the top of the cells was removed exposing the cells to air with continued contact with medium under t he transwell. The transwell cultures were harvested for total RNA as well as histology blocks 0, 2, 4, and 28 days after exposing the cells to air. For RNA harvest, cells were treated with trypsin for about 10 20 minutes at 37C to loosen them from the col lagen surface. The cells were then spun at 4,000xg, re suspended in RNA later (Ambion, Applied Biosystems; Foster City, CA) and stored at 70C until RNA preparation. RNA Preparation RNASE zap was used to decontaminate lab bench and materials (Ambion, Appl ied Biosystems; Foster City, CA) according to protocol, to inhibit Rnase activity. Total RNA was prepared using the MiRVana miRNA Isolation Kit (Ambion, Applied Biosystems; Foster City, CA) were tha wed on ice and spun at 15,000xg and the RNA later supernatant was removed, cells were then disrupted in a denaturing lysis buffer. The lysates were then subjected to acid phenol:chloroform extraction which removes most DNA and protein. Ethanol, 95%, was th en added to the aqueous solution and then the mixture passed through a filter cartridge by centrifugation, and the flow through was discarded. Samples were then put through a series of 95% ethanol washes, and the flow through was discarded.

PAGE 27

17 Finally, the f ilter cartridge was transferred into a fresh collection tube and 100L RNASE free water was added to the filters, containing bound RNA. The filter cartridge was centrifuged and the eluate containing the total RNA was collected and stored at 20C. The purified RNA was quantified using the Beckman DU 600 spectrophotometer. The absorbance at 260nm (A 260 ) was measured to determine the concentration of the RNA; a ratio of A 260 /A 280 >1.8 indicated a pure RNA sample, free of protein. The total RNA was exa mined for quality using the Agilent 2100 bioanalyzer (Agilent Technologies, Germany) to ensure that the total RNA samples were not degraded. The samples were analyzed using the RNA 6000 Nano LabChip assay, and was performed according to the Agilent RNA 600 0 Nano Assay protocol. The software calculates the ratio of the small and large ribosomal RNA peaks. A ratio of 1.8, or greater, indicated intact RNA; all time point samples displayed a ratio greater than 1.8 (Figures 4, 5) (Agilent 2100 Bioanalyzer Expert Figure 4 RNA 6000 Nano Assay G el visualization of ALI RNA T 0 T 28 Ladder Day 0 RNA Day 2 RNA Day 4 RNA Day 28 RNA

PAGE 28

18 Figure 5. RNA 6000 Nano Ladder of ALI RNA Ribosomal peaks of T 0 T 28 ; first two peaks represent RNA 6000 Nano Marker. Primer Design For each miRNA analyzed; miR 16, miR 15a, miR 15b, miR 424, miR 195, miR 497, forward (sense) orientation primers were designed using the 22nt mature miRNA Primers were synthesized by IDT DNA (www.IDTDNA.com) for use in end point PCR. miRNA Mature miRNA Sequence DNA Oligo miR 497 CAGCAGCACACUGUGGUUUGU CAGCAGCACACTGTGGTTTGT miR 16 UAGCAGCACGUAAAUAUUGGCG TAGCAGCACGTAAATATTGGCG miR 15b UAGCAGCACAUCAUGGUUUAC A TAGCAGCACATCATGGTTTACA miR 195 CCAAUAUUGGCUGUGCUGCUCC CCAATATTGGCTGTGCTGCTCC miR 15a UAGCAGCACAUAAUGGUUUGUG TAGCAGCACATAATGGTTTGTG miR 424 CAGCAGCAAUUCAUGUUUUGAA CAGCAGCAATTCATGTTTTGAA Table 4. Primer sequences. Mature miRNA p rimer sequences design ed from corresponding DNA oligo.

PAGE 29

19 Pilot Study Experiment The presence of miR 16, miR 15a, miR 15b, miR 424, miR 497 and miR 195 was assayed from T 0 total RNA (Figure 6). This experiment was performed according to the Quantimir RT kit (Systems Biosciences; Mountain View, CA) protocol and the resulting products were visually examined by ethidium bromide stained 1% Agarose gel electrophoresis. Figure 6 Preparation for QRT PCR assays. QuantiMir RT kit process of synthesis of cDNA to prepare for qPCR assay s. Quantitative Real Time PCR The cDNAs for all time points (0, 2, 4, 28) were synthesized according to the Quantimir RT kit protocol. Specifically, 10ng of total RNA were added to a 20L total reaction, to perform poly A tail synthesis of the miRNAs. Th e RNA was incubated with poly A polymerase for 30 minutes at 37C. Oligo dT anchor was annealed to each A tailed cDNA for 5 minutes at 60C and cooled to room temperature. Finally, reverse transcriptase was added, and incubated for 60 minutes at 42 C then heated for 10 minutes at 95C. For negative controls (no RT), additional reactions using RNA for time points 0,

PAGE 30

20 2, and 4 were performed as described above, except that the reverse transcriptase enzyme was omitted (Figure 7). Figure 7 Quantimir RT Kit Protocol Step by step s ynthesis of cDNA templates from total ALI RNA for QRT PCR. Polymerase chain reaction (PCR) was performed according to the Quantimir protocol conditions for real time quantitative PCR using Brilliant II SYBR Green (Stratagene ; La Jolla, CA). All PCR reactions, for all cDNAs, including no RT controls were performed in duplicate. QRT PCR detection of U6 snRNA was used to control for the total RNA levels, sample to sample. The reactions, plus controls, were put in one 96

PAGE 31

21 well pla te to perform quantitative PCR using a 7900HT Applied Biosciences real time PCR machine according to the Quantimir protocol. Specifically, the samples underwent initial heat denaturing at 95C for 10 minutes and then run for 30 cycles of heat denaturing at 95C for 15 seconds and primer annealing and extension at 60C for 1 minute. At the conclusion of the PCR cycling a melting curve experiment was performed to determine the purity of the products. The resulting products were visually examined by ethidium b romide stained 3.5% Agarose gel electrophoresis. RESULTS Computational Prediction of miRNAs Involved in Ciliogenesis The TargetScan 4.0 application was chosen because it searches the largest and most current miRNA database available, miRBase ( http://micro rna.sanger.ac.uk/sequences/ ). TargetScan also takes the phylogenetic conservation of target sites and the sequence of the miRNA seed match into account (Lewis et al., 2003; Grimson et al., 2007). Only those ciliary genes with conserved target sites that sc ored in the 75th percentile, or higher, were considered for further study. TargetScan calculates a total context score based on four features: site pairing contribution, and position contribution. Site type con tribution reflects the type of seed match, the seed being positions 2 7 of a mature miRNA; there are three different seed matches, 8mer, 7mer m8, and 7 mer1a. A 8mer seed match is an exact match to positions 2 8 of the mature miRNA (the seed + position 8) with a downstream 'A' across

PAGE 32

22 from base position 1 of the miRNA. A 7mer m8 seed match is an exact match to positions 2 8 of the mature miRNA (the seed + position 8) and a 7mer 1A seed match is an exact match to positions 2 7 of the mature miRNA (the seed) w ith a downstream 'A' across from base position 1 of the miRNA. Local AU contribution reflects transcript AU reflects consequential miRNA target complementarity outside the seed region, and position contribution reflects the distance to the nearest end of the annotated untranslated region ( UTR ) of the target (Grimson et al. 2007). TargetScan produces predicted miRNA targets divided into two category lists; homology across the 8 base pair seed sequence in human, mouse, rat, and dog while, poorly conserved targets are those that are not conserved across these four mammals. Additional features are cons idered to better predict target specificity; sites that are within ~15nt of the stop codon are flagged as they are less effective that those on the rest of the The cutoff omitted the weaker 7mer 1a seed matches which have exact matches only on posi tions 2 7 of the seed region whereas 8mer and 7mer m8 have exact matches on positions 2 8 of the mature miRNA. Within the 75 100 percentile context score percentile, there were 3 ciliary genes; GHR (growth hormone receptor), TUBA1A (Tubulin alpha 1a), and CGI 38 (Hypothetical Protein LOC52673) targeting miRNA; miR 16, miR 15a, miR 15b, miR 424, miR 195, miR 497 (Table 5 ). E xperimental validation of the hypothesis, that these miRNAs are expressed in undifferentiated human

PAGE 33

23 lung cells and that the timing of t heir down regulation of these miRNAs coincides with up regulation of ciliary genes during differentiation, was then performed. Gene Name miRNA Seed Match Context % GHR miR 497 8mer 98 GHR miR 16 8mer 98 GHR miR 15b 8mer 98 GHR miR 195 8mer 98 GHR miR 15a 8mer 98 GHR miR 424 8mer 98 TUBA1A miR 497 7mer m8 86 CGI 38 miR 16 7mer m8 84 MLF1 miR 29a 7mer m8 82 CGI 38 miR 195 7mer m8 81 MLF1 miR 29c 7mer m8 81 MLF1 miR 29b 7mer m8 81 TUBA1A miR 424 7mer m8 81 TTC30A miR 548b 7mer m8 78 TUBA1A miR 15b 7mer m8 75 TUBA1A miR 15a 7mer m8 75 Table 5. Candidate gene list. Genes with miRNA target site context scores of above 75%. Pilot Study: Detection of miRNAs in Undifferentiated Human Epithelial Cells The purpose of the pilot study was to determin e if any miRNA predicted to be targets of ciliary axoneme genes are expressed in undifferentiated human epithelial lung cells. PCR amplification of miR 16, miR 15a, miR 15b, miR 424, miR 195, and miR 497 was performed on undifferentiated cells (See Materi als & Methods) and were then visualized by 3.5% Agarose gel electrophoresis to verify a base pair size of approximately 55. Cell miRNAs tested were all amplified to a different extent. We observed that our miR 16 control, indicating the assay to

PAGE 34

24 be successful. These data indicate that miRNAs that target cilia genes are expressed in undifferentiated human air liquid interface cells. Double banding was observed for miR 195 and miR 497. This is likely the ampli fication product of a pri miRNA or mature miRNA (Figure 8). The miRNA specific primer anneals at the same location in pri miRNA and processed miRNA, but cannot distinguish between pri miRNA and mature miRNA. Therefore, the lower migrating band could repre sent smaller product of miR 195 and miR 497, most likely mature miRNA. The results of the pilot study indicated that our six candidate miRNAs are expressed in undifferentiated human air liquid interface epithelial cells. Figure 8 Visualization of pilot experiment. Agarose gel electrophoresis visualization of pilot experiment. (miR QRT PCR Analysis of MicroRNA in Differentiating ALI Cultures To quantify the six miRNAs of interest quantitative real time PCR w as performed using Brilliant II SYBR Green QRT PCR kit (Stratagene; La Jolla, CA). SYBR Green Base Pair Size

PAGE 35

25 binds to double stranded DNA and fluoresces. All six miRNA time points (0, 2, 4, 28) and no RT control time points (0, 2, 4) were performed in duplicate. These data are collected to formulate an amplification plot which reflects the cycle in which fluorescence of all samples greatly increases from the baseline, which occurred approximately between 1.000 E 1 th cycle (Figure 9) Fluorescence data are then collected from the thermal cycler. Figure 9. Amplification plot of data. The line of delineation indicates a cycle threshold (C t ), and data is collected at the time in which the sample crosses the threshold. In addition, a dissociation curve is formulated by the PCR samples being subjected to a stepwise increase in temperature from 55 to 95 with fluorescence measurements taken at every temperature incremen t at the beginning of the melting phase and again at the end of the melting phase (Figure 10) Ideally, only one peak should be

PAGE 36

26 present in the dissociation curve to indicate that all samples have the same melting point. The two major peaks formulated by t he results of the experiment indicate that there was one product that melted at 70C and another product melting at 78C, with s everal solitary peaks also present at approximately 75 C (Figure 10). According to the peak along with the subsequent minor peaks may have been primer dimers, double stranded molecules that synthesize as a result of two primers annealing to each other and are not specific to the miRNAs. The Quantimir RT kit does not filter out larger produ ct and a more sensitive kit should be used for future experimentation with miRNAs. Figure 10. Dissociation curve of products. Two peaks in dissociation curve; first melting point peak of 70C and the second melting point peak at 75C indicate pr imer dimers, the third melting point peak of 78C indicates melting point of all miRNAs to be identical.

PAGE 37

27 The results of the QRT PCR for each time point were normalized to T 0 using the 0 the expression of the miRNAs decreased at T 28 from 2 5 fold (Figure 11 ). Over time the expression of the six miRNAs appeared to remain unchanged over T 2 to T 4, and decrease at T 28 This supports my hypothesis that the expre ssion of the miRNAs decreases to allow for ciliogenesis. The results of the QRT PCR were also visualized by 3.5% Agarose gel electrophoresis (Figures 12ab, 13ab, 14ab ). Figure 11 Quantitation of data by Normalized QRT PCR results indicat e global decrease of miRNA expression at total cell differentiation,T 28. 4 3 2 1 0 1 2 3 0 2 8 28 log2(2^ days post air log2(2^ miR15a miR15b miR16 miR195 miR424

PAGE 38

28 Figure 12. A. miR 15b. Agarose gel electrophoresis visualization, from T 0 toT 28 B. miR 424. Agarose gel electrophoresis visualization, from T 0 toT 28 ; NORT = no revers e transcriptase. Figure 13 A. miR 16. Agarose gel electrophoresis visualization, from T 0 toT 28 B. miR 15a. Agarose gel electrophoresis visualization, from T 0 toT 28 Base Pair Size Base Pair Size A. A. B. B.

PAGE 39

29 Figure 14. A. miR 497. Agarose gel electrophoresis visualizatio n, from T 0 toT 28 B. miR 195. Agarose gel electrophoresis visualization, from T 0 toT 28 DISCUSSION MicroRNAs have recently been found to contribute to gene regulation by sequestering or targeting mRNAs for degradation (Cui et al., 2007), however, the c ontribution of miRNA regulation in lung epithelial differentiation had not been studied until now. Using a computational approach, multiple miRNAs were predicted to target genes of the cilia proteome known to be transcriptionally regulated in a human mode l of ciliated cell differentiation. The seven ciliary transcripts, which were previously shown to be up regulated during ciliogenesis, were investigated for conserved miRNA target sites. Base Pair Size A. B.

PAGE 40

30 Using TargetScan six miRNAs, miR 497, miR195, miR 16, miR 15a, miR 15b, and miR miRNA presence, and therefore function, to be an important regulatory mechanism in mammals. Quantitative real time PCR results indicated which miRNAs were detectable in undifferentiated lung epithelia, and showed that they decreased as the cells differentiated; consistent with a model of cilia gene repression (O strowski et al., 1998). These findings provide evidence for computational approaches to elucidate candidate miRNA regulators of ciliogenesis during differentiation of the airway epithelium. According to the results using SYBER Green for fluorescence during QRT PCR, miRNA expression increased until fully differentiated at day 28. As a result, more advanced experimental procedures were performed, by Dr. Juanita Martinez at Lovelace Respiratory Research Institute, using Taq Man Gene Expression Assays (App endix II). At the time that my experiment was performed, no experiments had been conducted to amplify miRNAs by QRT PCR. SYBER Green was a commonly used method as well as cost efficient for most applications and seemed to be the best option for miRNA det ection. Now that miRNA QRT PCR amplification has been done using the TaqMan assay, it is considered a more reasonable method for miRNA amplification as it is apparent that SYBER Green is not as sensitive. The TaqMan results obtained by Dr. Martinez (pers onal communication) further support not only the hypothesis that the six miRNAs are down regulated during differentiation, but that the expression of miRNAs gradually decreased beginning at T 2 to

PAGE 41

31 T 28 Given that cilia are first apparent at day 6 in ALI cu ltures, my results support my hypothesis that miR 497, miR195, miR 16, miR 15a, miR 15b, and miR 424 expression do indeed coincide with ciliogenesis (de Jong et al., 1994). These results suggest that miRNAs must be down regulated for ciliogenesis to occur So what occurs when miRNAs are up regulated rather than down regulated? Although this question has not been explored in regards to human lung ciliated genes in the airway epithelium, it has been studied in great detail in other bodily systems (Table 6). miRNA Up Regulation Found: miR 377 To cause increased fibronectin production in diabetic nephropathy (Wang et al., 2008) miR 155 In children with Burkitt Lymphoma (Metzler et al., 2003) miR 101, 126, 99a, 135, and 20 In Acute Megakaryoblastic L eukemia (AMKL) Cell Lines (Garz n et al., 2006) miR 203 To suppress cytokine 3 in psoriatic plaques (Sonkoly et al., 2007) miR 17 92 In human lung cancers; enhances cell proliferation (Hayashita et al., 2005) miR 26, 107, and 210 To decrease proapop totic signaling in a hypoxic environment ( Kulshreshtha et al., 2007) miR 26a To induce creatine kinase activity murine myogenic C2C12 cells, promoting myogenesis (Wong et al., 2008) miR 21 In allergic airway inflammation (Lu et al., 2009) Table 6 E xamples of up regulated microRNAs P resence and proposed function Mutations in miRNAs as well as dysregulation of miRNA biogenesis can result in a wide range of diseases, including cancers (Xu, 2008). Approximately 30% of human protein coding genes are potentially regulated by microRNAs and these are important

PAGE 42

32 biological processes such as apoptosis, differentiation, and development (Sassen et al, 2008). Atypical cell production is a classic indication of cancer, thus it is thought that patterns in micro RNA expression may be a key indicator in identifying cell malignancies. The ability of miRNAs to inhibit the translation of improperly matched target sites leads to the possibility of a single miRNA targeting multiple genes, thus the potential for several miRNAs to regulate a potential target on a given gene. Such a role in translational inhibition and destruction is being investigated as playing an important role in human disease (Meltzer, 2005). While the function of miRNAs in pathogenesis of disease is still a relatively novel field of scientific exploration the roles of cilia are well defined. Normal ciliary bea ting is vital to maintain normal respiratory function; immotile or dyskinetic respiratory cilia can cause defective mucociliary clearance resulting in chronic respiratory infections and inflammation of the airway ( Ibanez Tallon et al., 2003; V nde & Omran, 2005) In the case of newborn, idiopathic tachypnoea, chronic rhinitis and respiratory distress syndrome are often indicatory of primary cilia dyskinesia (PCD). Primary cilia dyskinesia will eventually progress to become bronchiectasis typi cally leading to lung failure in adulthood (Badano et al., 2006). Bardet Biedl syndrome (BBS), a recessive genetic condition which is a significant cause of end stage renal failure in children, is also due to dysfunction of the primary cilia. Characte ristic symptoms of this disease include obesity, diabetes, rod cone dystrophy, polydactyly, cognitive impairment and cardiomyopathy ( Katsanis et al. 2001 ) Defects of modified ce ntrioles at the base of cilia, basal bodies, are linked to Bardet Biedl

PAGE 43

33 syndrome (Blacque et al., 2004). Genes associated with BBS (BBS1, BBS1, and BBS7) encode proteins ( bbs 7, bbs 8 ) and are found predominantly at the base of cilia ( Nishimura et al. 2001 ; Mykytyn et al. 2002 ; Badano et al. 2003 ) Loss of function mutations of the bbs 7 and bbs 8 proteins result in functional and structural ciliary defects such as shortened or abnormal cilia and chemosensory abnormalities (Blacque et al., 2004) Mutations of BBS related proteins result in ciliary defects, but what causes mutations in these proteins? The proteins associated with BBS are located at the base of cilia and for these proteins to function normally it can be assumed that the cilium that they are located on must be healthy and normal for the proteins to function properly. If miRNA down regulation coincides with ciliogenesis it is possible that, in the case of Bardet Biedl syndrome, miRNA expression is upregulated in BBS associated genes thus encoding for mutant BBS proteins and ultimately resulting in ciliary defects. Many proteins that are involved in cystic diseases localize to basal bodies found at the base of cilia, including polycystic kidney disease (PK D) ( Huang et al., 2007). In the kidneys, primary cilia are found on the apical surface of the epithelium and are present on cells of the nephron, the basic functional unit of the kidneys. The proteins polycystin 1 and polycystin 2, which are involved in PKD, localize to the cil ia of sensory neurons and are thought to be imperative in preserving behavioral responses that require cilia function (Barr & Sternberg 1999) There are many models relating cilia and PKD indicating that cilia are important for normal maintenance of renal physiology and play a considerably important role in renal development (Praetorius & Spring, 2001; Grimm et

PAGE 44

34 al., 2003; Nauli et al., 2003; Praetorius & Spring, 2003; Liu et al., 2005; Low et al., 2006; Shillingford et al., 2006). Both BBS and Polycystic Kidney disease are caused by loss of function mutations of their associated proteins thus resulting in abnormal ciliary function and/or ciliary defects. Considering the role of cilia in both BBS and PKD, one can hypothesize that perhaps th e alteration of proteins in both are associated with miRNA expression. In both cases if miRNAs are up regulated, rather than down regulated, it is possib le that improper ciliogenesis will result in abnormal maintenance and development of these systems. I t is clear that cilia are essential in maintaining normal tissue and organ function within the body, thus the formation of new cilia, or ciliogenesis, is equally as important. Abnormal or the absence of ciliogenesis can result in a wide range of diseases, disorders, and syndromes due to defective or immotile cilia. Thus understanding the pathway involved in the formation of new cilia could very well lead to early intervention or even prevention of these ailments. This experiment support s my hypothesis th at miRNA expression coincides with ciliogenesis and is down regulated with the formation of cilia and provides evidence to support the idea that miRNAs may soon be com e a therapeutic target and intervention tool of the future (Liu et al., 2008)

PAGE 45

A I Appendix I. Gene Description C10orf63 Chromosome 10 open reading frame 63 C6orf97 Chromosome 6 open reading frame 97 CAPS Calcyphosine CETN2 Centrin, EF hand protein, 2 CGI 38 Brain specific protein CLUAP1 Clusterin associated protein 1 DNAH9 Dyne in, axonemal, heavy polypeptide 9 DNAI1 Dynein, axonemal, intermediate polypeptide 1 DNAI2 Dynein, axonemal, intermediate polypeptide 2 DNALI1 Dynein, axonemal, light intermediate polypeptide 1 DYDC2 DPY30 domain containing 2 EFHC1 EF hand domain (C t erminal) containing 1 EFHC2 EF hand domain (C terminal) containing 2 FLJ13946 Hypothetical protein FLJ13946 FLJ23577 KPL2 protein GHR Growth hormone receptor HSPA1A Heat shock 70 kD protein 1A IFT57 Intraflagellar transport 57 homolog ( Chlamydomonas ) IFT81 Intraflagellar transport 81 homolog ( Chlamydomonas ) IFT88 Intraflagellar transport 88 homolog ( Chlamydomonas ) IQCE Homo sapiens IQ motif containing E (IQCE), mRNA LRRC23 Leucine rich repeat containing 23 MLF1 Myeloid leukemia factor 1 MNS1 Mei osis specific nuclear structural protein 1 NME5 Non metastatic cells 5, protein expressed in (nucleoside diphosphate kinase) RABL4 RAB, member of RAS oncogene family like 4 RABL5 RAB, member of RAS oncogene family like 5 RIBC2 RIB43A domain with coiled coils 2 ROPN1L Ropporin 1 like RTDR1 Rhabdoid tumor deletion region gene 1 SPA17 Sperm autoantigenic protein 17 SPAG6 Sperm associated antigen 6 TEKT2 Tektin 2 (testicular) TUBA3 Tubulin, alpha 3 TUBA4 Tubulin, alpha 4 TUBB2 Tubulin, beta, 2 ZEMN D12 Zinc finger, MYND domain containing 12 Table A I Ciliary Gene Descriptions. T hirty seven genes of the ciliary axoneme of the human lung (Ross et al 2007).

PAGE 46

A II Appendix II TaqMan Assay Experiment Data Generated by Dr. Juanita Martinez A total of 369 TaqM an assays were performed by Dr. Juanita Martinez, on a single Applied Bio systems low density miRNA array; 365 of these were human miRNAs and the rest were controls. TaqM an expression data was normalized to the small nuclear RNA U6, an RNA whose abundance is expected to only change with respect to cell growth but not cell signa ling (differentiation). Next, t he dataset was normalized to T 0 and t he data were clustered (K M eans and SmoothTree) by expression in Genespring 7.3. B lack indicates down regulation relative to T 0 whi le red indicates upregulation, y ellow indicates no change. K Means clusters are shown as colored groups. The yellow K means cluster indicate s miRNAs that are downregulated beginning at T 2 and continue to be downregulated to T 28 Among these miRNAs are the 6 miR NA s that are predicted to target ciliary axoneme genes. Figure A II Data by TaqMan assays. Genespring 7.3 g lobal r eal time PCR expression analysis of miRNAs during d ifferentiation ; clustered (complete avera ge) K Mean s and SmoothTree data K Means : Fold Change Key:

PAGE 47

REFERENCES Adams, M.D., Kelley, J.M., Gocayne, J.D., Dubnick, M., Polymeropoulos, M.H., Xiao, H., Merril, C.R., Wu, A., Olde, B., Moreno, R.F. (1991). Complementary DNA sequencing: expressed sequence tags and human genome project. Science. 252(5013): 1651 6. Afzelius, B.A. (1976). A human syndrome caused by immotile cilia. Science 193: 317 319. Afzelius B A. (2004). Cilia related diseases. J Pathol 204 : 470 7 Ambros, V. (2003). MicroRNA pathways in flies and worms: growth, death, fat, s tress, and timing. Cell 113(6): 673 6. Ambros, V., Lee, R.C., Lavanway, A., Williams, P.T., Jewell, D. (2003). MicroRNAs and other tiny endogenous RNAs in C. elegans. Curr Biol 13(10): 807 18. Ambros, V. (2004). The functions of animal microRNAs. Nature 431(7006): 350 5. Auclair, W. and Siegal, B.W. (1966). Cilia regeneration in the sea urchin embryo: evidence for a pool of ciliary proteins. Science, N. Y. 154, 913 915. Badano J L Ansley S J Leitch C C Lewis R A Lupski J R Katsanis N. (2 003). Identification of a novel Bardet Biedl syndrome protein, BBS7, that shares structural features with BBS1 and BBS2. Am J Hum Genet. 72 : 650 8 Badano, J.L. and Katsanis, N. (2006). Life without centrioles: cilia in the spotlight. Cell 125(7): 1228 1230 Barr, M. M. and Sternberg, P. W. (1999). A polycystic kidney disease gene homologue required for male mating behaviour in C. elegans Nature 401 386 389 Bartel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116(2): 2 81 97. Blacque O.E. Reardon, M.J., Li, C., McCarthy, J., Mahjoub, M.R., Ansley, S.J., Badano, J.L., Mah, A.K., Beales, P.L., Davidson, W.S., Johnsen, R.C., Audeh, M., Plasterk, R.H.A., Baillie, D.L., Katsanis, N., Quarmby, L.M., Wicks, S.R., Leroux, M.R. ( 2004 ). Loss of C. elegans BBS 7 and BBS 8 protein function results in cilia defects and compromised intraflagellar transport. Genes Dev 18(13): 1630 1642. Brennecke, J., Stark, A., Russell, R.B., and Cohen, S.M. 2005. Principles of microRNA target recognition. PLoS Biol. 3: e85.

PAGE 48

Brokaw, C.J. (1961). Movement and nucleoside polyphosphatase activity of isolated flagella from Polytoma uvella. Exp. Cell Res. 22: 151 162. Brokaw, C.J. (1965). Non sinusoidal beinding waves of sperm flagella. J. Exp. Bio l. 43: 155 169. Carletti, M., and L. K. Christenson. 2008. MicroRNA in the ovary and female reproductive tract. J Anim Sci. 87:E29 E38. Chen, X. (2004). A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 303(5666): 2022 5. Chu, C. Y. and Rana T.M. (2006). Translation repression in human cells by microRNA induced gene silencing requires RCK/p54. PLoS Biol 4(7): e210. Chu A.S. and Friedman, J.R. ( 2008 ). A role for microRNA in cystic liver and kidney diseases J. Clin. Invest. 118 (11): 3585 3587. Costello, D.P. (1973). A new theory on the mechanics of ciliary and flagellar motility. Biol Bull 145: 292 309. Cui, T., Moro oka, N., Ohsumi, K., Kodama, K., Ohshima, T., Ogasawara, N., Mori, H., Wanner, B. Niki, H., Horiuchi, T. ( 2007 ). Escherichia coli with a linear genome EMBO Rep 8 : 181 187. de Jong P.M., van Sterkenburg, M.A., Hesseling, S.C., Kempenaar, J.A., Mulder, A.A., Mommaas, A.M., Dijkman, J.H., Ponec, M. ( 1994 ). Ciliogenesis in human bronchial epithelial cells cultured at the air liquid interface Am. J. Respir. Cell Mol. Biol ., 10(3): 271 277. Dellinger, O.P. (1909). The cilium as a key to the structure of contractile protoplasm. J. Morphol. 20: 171 210. Dobell, C. (1958). Antony v an Leeuwenhoek and His Litte Animals. New York: Russell and Russell. Doench J. G., Petersen, C. P., Sharp, P.A. (2003). siRNAs can function as miRNAs. Genes Dev 17(4): 438 42. Doench J.G. and Sharp, P.A. ( 2004 ). Specificity of microRNA target selectio n in translational repression Genes & Dev. 18: 504 511 Dutcher, S. K., Huang, B., Luck, D.J. ( 1984). Genetic dissection of the central pair microtubules of the flagella of Chlamydomonas reinhardtii J. Cell Biol. 98 : 229 236.

PAGE 49

Farh K.K., Grimson A., Jan, C., Lewis, B.P., Johnston, W.K., Lim, L.P., Burge, C.B., Bartel, D.P. ( 2005 ). The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Science 310(5755):1817 21. Fawcett, D., and Porter, K.R. (1954). A study of the fine str ucture of ciliated epithelia. J. Morphol. 94: 221 281. Fire, A., Xu, S., Montgomery, M., Kostas, S., Mello, C. (1998). Potent and specific genetic interference by double stranded RNA in Caenorhabditis elegans Natura 391: 806 811. Fleishmann, R.D., Adams, M.D., White, O., Clayton, R.A., Kirkness, E.F., Kerlavage, A.R., Bult, C.J., Tomb, J.F., Dougherty, B.A., Merrick, J.M. (1995). Whole genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269, 496 512 F rench, D.,Wilkinson, M.R., Yang, W., de Chaisemartin, L., Cook, E.H., Das, S., Ratain, M.J., Evans, W.E., Downing, J.R., Pui, C. H., Relling, M.V. (2005). Global gene expression as a function of germline genetic variation. Hum. Mol. Genet. 14 1621 1629 Garz n R Fabbri, M., Cimmino, A., Calin, G.A., Croce, C.M. (2006) MicroRNAs expression and function in cancer. Trends Mol Med 12:580 587. Gelei, J. (1927). Eine neue Osmium Toluidin methode fr Protistenforschung. Mikrokosmos 20: 97 103. Gibbons, I.R., and Rowe, A.J. (1965). Dynein: a protein with adenosine triphosphatase activity from cilia. Science 149: 424 425. Giraldez A. J., Mishima, Y., Rihel, J., Grocock, R.J., Van Dongen, S., Inoue, K., Enright, A.J., Schier, A.F. (2006). Zebrafish MiR 430 promo tes deadenylation and clearance of maternal mRNAs. Science 312(5770): 75 9. Gray, J. (1928). Ciliary Movement. Cambridge U.K.,: Cambridge Univ. Press. Gray, J. (1930). The mechanisms of ciliary movement. VI. Photographic and stroboscopic analysis of cilia ry movement. Proc. R. Soc. Lond. Biol 107B: 313 332. Gray, J. (1955). The movement of sea urchin spermatozoa J. Exp. Biol. 32: 775 801. Gray, J., and Hancock, G.J. (1955). The propulsion of sea urchin spermatozoan. J. Exp. Biol 32: 802 814. Grimm, D. H., Cai, Y., Chauvet, V., Rajendran, V., Zeltner, R., Geng, L., Avner, E.D., Sweeney, W., Somlo, S., Caplan, M.J. (2003). Polycystin 1 Distribution Is Modulated by Polycystin 2 Expression in Mammalian Cells. J. Biol. Chem. 278 36786 36793

PAGE 50

Grimson, A. Farh, K.K., Johnston, W.K., Garrett Engele, P., Lim, L.P., Bartel, D.P. ( 2007 ). MicroRNA Targeting Specificity in Mammals: Determinants beyond Seed Pairing Molecular Cell 27(1): 91 105 Hayashita, Y., Osada, H., Tatematsu, Y., Yamada, H., Yanagisawa, K., Tomida, S., Yatabe, Y., Kawahara, K., Sekido, Y., Takahashi, T. (2005 ) A polycistronic microRNA cluster, miR 17 92, is overexpressed in human lung cancers and enhances cell proliferation, Cancer Res. 65 9628 9632. He, L. and Hannon, G. J. (2004). MicroRNAs: small RNA s with a big role in gene regulation. Nat Rev Genet 5(7): 522 31. He, L., Thomson, J. M., Hemann, M.T., Hernando Monge, E., Mu, D., Goodson, S., Powers, S., Cordon Cardo, C., Lowe, S.W., Hannon, G.J., Hammond, S.M. (2005). A microRNA polycistron as a po tential human oncogene. Nature 435(7043): 828 33. Hillel, J., Plotsky, Y., Haberfeld, A., Lavi, U., Cahaner, A., Jeffreys, A.J. (1989). DNA fingerprints in poultry. Anim Genet 20 145 155. Hutvagner, G. and Zamore, P. D. (2002). A microRNA in a multiple turnover RNAi enzyme complex. Science 297(5589): 2056 60. Ibez L Potau, N., Enrquez, G., Marcos, M.V., de Zegher, F. ( 2003 ). Hypergonadotropinemia with reduced uterine and ovarian size in women born small for gestational age. Hum Reprod 18: 1565 1569. Ibanez Tallon, I., Heintz, N., Omran, H. (2003). To beat or not to beat: roles of c ilia in development and disease. Hum. Mol. Genet. 12 R27 R35. Jackson, D.A. Symons, R.H., Berg, P. (1972). Biochemical method for inserting new genetic information into DNA of simian virus 40: Circular SV 40 DNA molecules containing lambda phage genes and the galactose operon of Escherichia coli. Proc N at Acad Sci 69, 2904 2909 Katsanis, N., Ansley, S.J., Badano, J.L., Eichers E.R., Lewis, R.A., Hoskins, B.E., Scambler, P.J., Davidson, W.S., Beales, P.L., Lupski, J.R. ( 2001 ). Triallelic Inheritance in Bardet Biedl Syndrome a Mendelian Recessive Disorder. Science 293(5538): 2256 2259 Kh vorova, A., Reynolds, A., Jayasena, S.D. (2003). Functional siRNAs and miRNAs exhibit strand bias. Cell 115(2): 209 16. Kirk, D.L. (1998). Volvox: molecular genetic origins of multicellularity and cellular differentiation. Cambridge University Press, Cambridge. 381 pp

PAGE 51

Knight D.A. and H olgate, S.T. ( 2003 ). The airway epithelium: Structural and functional properties in health and disease. Resp. 8(4): 432 446. Krek, A., Grn, D., Poy, M.N., Wolf, R., Rosenberg, L., Epstein, E.J., MacMenamin, P., da Piedade, I., Gunsalus, K.C., Stoffel, M., Rajews ky, N. (2005). Combinatorial microRNA target predictions. Nat. Genet 37 : 495 500. Krtzfeldt J., Rajewsky, N., Braich, R., Rajeev, K.G., Tuschl, T., Manoharan, M., Stoffel, M. Nature. 438 (70 68): 685 689. Kulshreshtha R., Ferracin, M., Wojcik, S.E., Garzon, R., Alder, H., Agosto Perez, F.J., Davuluri, R., Liu, C.G., Croce, C.M., Negrini, M., Calin, G.A., Ivan, M. ( 2007 ). A microRNA signature of hypoxia. Mol. Cell. Biol. 27(5): 1859 1867 Lagos Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. (2001). Identification of novel genes coding for small expressed RNAs. Science 294(5543): 853 8. Lai, E.C., Tam, B., Rubin, G.M. (2005). Pervasive regulation of Drosophila Notch target genes by GY box Brd box and K box class microRNAs. Genes & Dev. 19 : 1067 1080. Lander E.S., Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, Devon K, Dewar K, Doyle M, FitzHugh W, Funke R, Gage D, Harris K, Heaford A, Howland J, Kann L, Lehoczky J, LeVine R, McEwan P, McKernan K, Meldrim J, Mesirov JP, Miranda C, Morris W, Naylor J, Raymond C, Rosetti M, Santos R, Sheridan A, Sougnez C, Stange Thomann N, Stojanovic N, Subramanian A, Wyman D, Rogers J, Sulston J, Ainscough R, Beck S, Bentley D, Burton J, Clee C, Carte r N, Coulson A, Deadman R, Deloukas P, Dunham A, Dunham I, Durbin R, French L, Grafham D, Gregory S, Hubbard T, Humphray S, Hunt A, Jones M, Lloyd C, McMurray A, Matthews L, Mercer S, Milne S, Mullikin JC, Mungall A, Plumb R, Ross M, Shownkeen R, Sims S, W aterston RH, Wilson RK, Hillier LW, McPherson JD, Marra MA, Mardis ER, Fulton LA, Chinwalla AT, Pepin KH, Gish WR, Chissoe SL, Wendl MC, Delehaunty KD, Miner TL, Delehaunty A, Kramer JB, Cook, L.L., Fulton, R.S., Johnson, D.L., Minx, P.J., Clifton, S.W., H awkins, T., Branscomb, E., Predki, P., Richardson, P., Wenning, S., Slezak, T., Doggett, N., Cheng, J.F., Olsen, A., Lucas, S., Elkin, C., Uberbacher, E., Frazier, M., Gibbs, R.A., Muzny, D.M., Scherer, S.E., Bouck, J.B., Sodergren, E.J., Worley, K.C., Riv es, C.M., Gorrell, J.H., Metzker, M.L., Naylor, S.L., Kucherlapati, R.S., Nelson, D.L., Weinstock, G.M., Sakaki, Y., Fujiyama, A., Hattori, M., Yada, T., Toyoda, A., Itoh, T., Kawagoe, C., Watanabe, H., Totoki, Y., Taylor, T., Weissenbach, J., Heilig, R., Saurin, W., Artiguenave, F., Brottier, P., Bruls, T., Pelletier, E., Robert, C., Wincker, P., Smith, D.R., Doucette Stamm, L., Rubenfield, M., Weinstock, K., Lee, H.M., Dubois, J., Rosenthal, A., Platzer, M., Nyakatura, G., Taudien, S., Rump, A., Yang, H., Yu, J.,

PAGE 52

Wang, J., Huang, G., Gu, J., Hood, L., Rowen, L., Madan, A., Qin, S., Davis, R.W., Federspiel, N.A., Abola, A.P., Proctor, M.J., Myers, R.M., Schmutz, J., Dickson, M., Grimwood, J., Cox, D.R., Olson, M.V., Kaul, R., Raymond, C., Shimizu, N., Kawas aki, K., Minoshima, S., Evans, G.A., Athanasiou, M., Schultz, R., Roe, B.A., Chen, F., Pan, H., Ramser, J., Lehrach, H., Reinhardt, R., McCombie, W.R., de la Bastide, M., Dedhia, N., Blcker, H., Hornischer, K., Nordsiek, G., Agarwala, R., Aravind, L., Bai ley, J.A., Bateman, A., Batzoglou, S., Birney, E., Bork, P., Brown, D.G., Burge, C.B., Cerutti, L., Chen, H.C., Church, D., Clamp, M., Copley, R.R., Doerks, T., Eddy, S.R., Eichler, E.E., Furey, T.S., Galagan, J., Gilbert, J.G., Harmon, C., Hayashizaki, Y. Haussler, D., Hermjakob, H., Hokamp, K., Jang, W., Johnson, L.S., Jones, T.A., Kasif, S., Kaspryzk, A., Kennedy, S., Kent, W.J., Kitts, P., Koonin, E.V., Korf, I., Kulp, D., Lancet, D., Lowe, T.M., McLysaght, A., Mikkelsen, T., Moran, J.V., Mulder, N., P ollara, V.J., Ponting, C.P., Schuler, G., Schultz, J., Slater, G., Smit, A.F., Stupka, E., Szustakowski, J., Thierry Mieg, D., Thierry Mieg, J., Wagner, L., Wallis, J., Wheeler, R., Williams, A., Wolf, Y.I., Wolfe, K.H., Yang, S.P., Yeh, R.F., Collins, F., Guyer, M.S., Peterson, J., Felsenfeld, A., Wetterstrand, K.A., Patrinos, A., Morgan, M.J., de Jong, P., Catanese, J.J., Osoegawa, K., Shizuya, H., Choi, S., Chen, Y.J.; International Human Genome Sequencing Consortium. ( 2001 ). Initial sequencing and analy sis of the human genome. Nature 409(6822): 860 921. Lau, N. C., Lim, L.P., Weinstein, E.G., Bartel, D.P. (2001). An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294(5543): 858 62. Lee R C Feinbaum R L Ambros V. (1993). The C. elegans heterochronic gene lin 4 encodes small RNAs with antisense complementarity to lin 14 Cell. 75(5):843 54. Lee, R. C. and Ambros, V. (2001). An extensive class of small RNAs in Caenorhabditis elegans. Science 294(5543): 862 4. Lee, Y., Jeon, K., Lee, J.T., Kim, S., Kim, V.N. (2002). MicroRNA maturation: stepwise processing and subcellular localization. Embo J 21(17): 4663 70. Lepage T., Gache, C. ( 1990 ). Early expression of a collagenase like hatching enzyme gene in the sea urchin embryo. EMBO J. 9 3003 3012. LeSimple, P., van Seuningen, I., Buisine, M.P., Copin, M.C., Hinz, M., Hoffmann, W., Hajj, R., Brod y, S.L., Coraux, C., Puchelle, E. (2006). Trefoil Factor Family 3 Peptide Promotes Human Airway Epithelial Ciliated Cell Differentiation. Am. J. Respir. Cell Mol. Biol 36 (3): 296 303 Levine E., Zhang, Z., Kuhlman, T., Hwa, T. ( 2007 ). Quantitative Characteristics of Gene Regulation by Small RNA PLoS Biol 5(9): e229.

PAGE 53

Lewis, B. P., Shih, I.H., Jones Rhoades, M.W., Bartel, D.P., Burge, C.B. (2003). Prediction of mammalian microRNA targets. Cell 115(7): 787 98. Lewis, B. P., Burg e, C.B., Bartel, D.P. (2005). Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120(1): 15 20. Lin, S. Y., Johnson, S.M., Abraham, M., Vella, M.C., Pasquinelli, A., Gamberi, C., Gottlieb, E., Slack, F.J (200 3). The C elegans hunchback homolog, hbl 1, controls temporal patterning and is a probable microRNA target. Dev Cell 4(5): 639 50. Lai, E.C., Tam, B., Rubin, G.M. (2005). Pervasive regulation of Drosophila Notch target genes by GY box Brd box and K bo x class microRNAs. Genes & Dev. 19 : 1067 1080. Liu J., Valencia Sanchez, M.A., Hannon, G.J., Parker, R. ( 2005 ). MicroRNA dependent localization of targeted mRNAs to mammalian P bodies Nat. Cell. Biol. 7 : 719 723 Liu Z., Sall, A., Yang, D. ( 2008 ). MicroRNA : an Emerging Therapeutic Target and Intervention Tool. International Journal of Molecular Sciences 9(6):978 999. Llave, C., Xie, Z., Kasschau, K.D., Carrington, J.C. (2002). Cleavage of Scarecrow like mRNA targets directed by a class of Arabidops is miRNA. Science 297(5589): 2053 6. Look D.C Walter, M.J., Williamson, M.R., Pang, L., You, Y., Sreshta, J.N., Johnson, J.E., Zander, D.S., Brody, S.L. ( 2001 ). Effects of Paramyxoviral Infection on Airway Epithelial Cell Foxj1 Expression, Ciliogenesis, and Mucociliary Function American Journal of Pathology. 159:2055 2069. Low S.H., Vasanth, S., Larson, C.H., Mukherjee, S., Sharma, N., Kinter, M.T., Kane, M.E., Obara, T., Weimbs, T. ( 2006 ). Polycystin 1, STAT6, and P100 function in a pathway that transduces ciliary mechanosensation and is activated in polycystic kidney disease. Dev. Cell 10, 57 69. Lu, J., Getz, G., Miska, E.A., Alvarez Saavedra, E., Lamb, J., Peck, D., Sweet Cordero, A., Ebert, B.L., Mak, R.H., Ferrando, A.A., Downing, J.R., Jac ks, T., Horvitz, H.R., Golub, T.R. ( 2005 ). MicroRNA expression profiles classify human cancers. Nature 435: 834 838. Lu, T.X., Munitz, A., Rothenberg, M.E. ( 2009 ). MicroRNA 21 Is Up Regulated in Allergic Airway Inflammation and Regulates IL 12p35 Expression The Journal of Immunology 182: 4994 5002.

PAGE 54

Mahjoub, M.R., Montpetit, B., Zhao, L., Finst, R.J., Goh, B., Kim, A.C., Quarmby, L.M. (2002). The FA2 gene of Chlamydomonas encodes a NIMA family kinase with roles in cell cycle progression and microt ubule severing during deflagellation. J. Cell Sci. 115 :1759 1768. Manton, I. (1952). The fine structure of plant cilia. Symp. Soc. Exp. Biol 6: 306 319. Manton, I., and Clarke, B. (1952). An electron microscope study of the spermatozoid of Sphagnum. J. Exp. Bot. 3: 265 275. Matranga C., Tomari, Y., Shin, C., Bartel, D.P., Zamore, P.D. ( 2005 ). Passenger Strand Cleavage Facilitates Assembly of siRNA into Ago2 Containing RNAi Enzyme Complexes. Cell 123 : 607 620. Metzler M., Wilda, M., Busch, K., Viehma nn, S., Borkhardt, A. ( 2003 ). High expression of precursor microRNA 155/ BIC RNA in children with Burkitt lymphoma Genes, Chromosomes and Cancer 39( 2 ): 167 169 Meltzer, S. (2005). Small RNAs with big impacts. Nature 435 (9): 745 746. Muller, O.F. (1786). Animalcula Infusoria Fluviatilia et Marina. Havniae. Mullis, K Faloona F., Scharf, S., Saiki, R., Horn, G., Erlich, H. (1986). Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Quant. Biol. 51: 263 273. Mykytyn K., Nishimura, D.Y., Searby, C.C., Shastri, M., Yen, H.J., Beck, J.S., Braun, T., Streb, L.M., Cornier, A.S., Cox, G.F., Fulton, A.B., Carmi, R., Lleci, G., Chandrasekharappa, S.C., Collins, F.S., Jacobson, S.G., Heckenlively, J.R., Weleber, R.G., Stone, E.M. Sheffield, V.C. ( 2002 ). Identification of the gene (BBS1) most commonly involved in Bardet Biedl syndrome, a complex human obesity syndrome. Nat Genet. 31 : 435 8 Nauli S.M., Alenghat, F.J., Luo, Y., Williams, E., Vassilev, P., Li, X., Elia, A.E., Lu, W ., Brown, E.M., Quinn, S.J., Ingber, D.E., Zhou, J. ( 2003 ). Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells. Nat. Genet. 33(2):129 37. Nishimura D.Y., Searby, C.C., Carmi, R., Elbedour, K., Van Maldergem, L., Fulton, A.B., Lam, B.L., Powell, B.R., Swiderski, R.E., Bugge, K.E., Haider, N.B., Kwitek Black, A.E., Ying, L., Duhl, D.M., Gorman, S.W., Heon, E., Iannaccone, A., Bonneau, D., Biesecker, L. G., Jacobson, S.G., Stone, E.M., Sheffield, V.C. ( 2001 ). Positional cloning of a novel gene on chromosome 16q causing Bardet Biedl syndrome (BBS2). Hum Mol Genet 10 : 865 74

PAGE 55

Ostrowski L.E., Andrews, K.L., Potdar, P.D., Nettesheim, P. ( 1998 ). Ciliated cell differentiation and gene expression Protoplasma 206(4): 245 248. Ostrowski, L.E., Blackburn, K., Radde, K.M., Moyer, M.B., Schlatzer, D.M., Moseley, A., Boucher, R.C. ( 2002 ). A proteomic analysis of human cilia: identification of novel compo nents. Mol. Cell. Proteomics 1, 451 465. Pazour G J Agrin N Leszyk J Witman G B ( 2005). Proteomic analysis of a eukaryotic cilium J. Cell. Bio. 170 (1) : 103 113. Peculis, B. A. and Steitz, J. A. (1993). Disruption of U8 nucleolar snRNA inhibits 5. 8S and 28S ribosomal RNA processing in the Xenopus oocyte. Cell 73 1233 1245. Praetorius, H.A. and Spring K.R. (2001). Bending the MDCK cell primary cilium increases intracellular calcium. J. Membr. Biol ., 184: 71 79. Praetorius, H.A. and Spring, K.R. (2003). The renal cell primary cilium functions as a flow sensor. Curr. Opin. Nephrol. Hypertens 12: 517 52 0. J.E., and Valentin, G. (1835). De phaenomeno generali et fundamentali motus vibratorii continui in membranis cum externis tum internis animalium plurimorum et superiorum et inferiorum ordinum obvii. Commentatio physiologica. Wratislavia: A Schu ltz. Huang, K., Diener, D.R., Mitchell, A., Pazour, G.J., Witman, G.B., Rosenbaum, J.L. (2007). Function and dynamics of PKD2 in Chlamydomonas reinhardtii flagella J Cell Biol. 179(3):501 14. Poy, M. N., Eliasson, L., Krutzfeldt, J., Kuwajima, S., Ma, X. Macdonald, P.E., Pfeffer, S., Tuschl, T., Rajewsky, N., Rorsman, P., Stoffel, M. (2004). A pancreatic islet specific microRNA regulates insulin secretion. Nature 432(7014): 226 30. Raff, R.A., Greenhouse, G., Gross, K.W., Gross, P.R. ( 1971 ). Synthesis an d storage of microtubule proteins by sea urchin embryos. J Cell Biol. 50 (2):516 527. Reinhart, B.J., Weinstein, E.G., Rhoades, M.W., Bartel, B., Bartel, D.P (2002). MicroRNAs in plants. Genes Dev. 16(13):1616 26. Rodriguez A., Vigorito, E., Clare, S., Warren, M.V., Couttet, P., Soond, D.R., van Dongen, S., Grocock, R.J., Das, P.P., Miska E.A., Vetrie, D., Okkenhaug, K., Enright, A.J., Dougan, G., Turner, M., Bradley, A. ( 2007 ). Requirement of bic/microRNA 155 for Normal Immune Function Science 316(5824): 608 611

PAGE 56

Ross A.J., Dailey, L.A., Brighton, L.E., Devlin, R.B. ( 2007 ). Transcript ional Profiling of Mucociliary Differentiation in Human Airway Epithelial Cells Amer. Jour. Resp. Cell. Mol. Biol. 37, 169 185 Saini, H.K., Griffiths Jones, S., Enright, A.J. ( 2007 ). Genomic analysis of human microRNA transcripts Proc. Natl. Acad. Sci. 104 (45):17719 24. Sale, W.S., and Satir, P. (1977). Direction of active sliding of microtubules in Tetrahymena cilia. Proc. Natl. Acad. Sci. U.S.A. 74: 2045 2049. Sanger F., Nicklen, S., Coulson, A.R. ( 1977 ). DNA Sequencing with Chain Terminating Inhibit o rs. Proc. Natl. Acad. Sci 74(12): 5463 5468. Satir, P. (1965). Studies on cilia: II. Examination of the distal region of the ciliary shaft and the role of filaments in motility. J. Cell Biol 26: 805 834. Sassen, S., Miska. E.A., Caldas, C. (2008). Micr oRNA implications for cancer. Virchows. Arch. 452: 1 10. Sharp, P.A., Sugden, B., Sambrook, J. (1973). Detection of two restriction endonuclease activities in Haemophilus parainfluenzae using analytical agarose -ethidium bromide electrophoresis. Biochem istry. 12 (16):3055 3063. Shen, Y., Ji, G., Haas, B.J., Wu, X., Zheng, J., Reese, G.J., Li, Q.Q. (2008). Genome level analysis of rice mRNA 3' end processing signals and alternative polyadenylation. Nucleic Acids Res 36: 3150 3161 Shillingford J.M., Murcia, N.S., Larson, C.H., Low, S.H., Hedgepeth, R., Brown, N., Flask, C.A., Novick, A.C., Goldfarb, D.A., Kramer Zucker, A., Walz, G., Piontek, K.B., Germino, G.G., Weimbs, T. ( 2006 ). The mTOR pathway is regulated by polycystin 1, and its inhibit ion reverses renal cystogenesis in polycystic kidney disease. Proc. Natl. Acad. Sci 103 :5466 5471. Sonkoly E., Wei, T., Janson, P.C., Sf, A., Lundeberg, L., Tengvall Linder, M., Norstedt, G., Alenius, H., Homey, B., Scheynius, A., Sthle, M., Pivarcsi, A. ( 2007 ). MicroRNAs: novel regulators involved in the pathogenesis of psoriasis. PLoS Biol 2: e610 Stephens, R.E. ( 1977 ). Differential protein synthesis and utilization during cilia formation in sea urchin embryos. Dev. Biol. 61: 311 329. Stephens, R .E. ( 1994 ). Tubulin and tektin in sea urchin embryonic cilia: pathways of protein incorporation during turnover and regeneration. J. Cell. Sci. 107:683 692

PAGE 57

Sugrue, P., Avolio, J., Satir, P., and Holwill, M.E.J. (1991). Computer modeling of Tetrahymena axonemes at macromolecular resolution: interpretation of electron micrographs. J. Cell Sci 98: 5 16. Thompson A.B., Robbins, R.A., Romberger, D.J., Sisson, J.H., Spurzem, J.R., Teschler, H., Rennard, S.I. ( 1995 ). Immunological functions of the pulmonary epithelium Eur. Respir. J. 8: 127 149 Vallery Radot, Rene. (1901). The Life of Pasteur. The Star Series. Garden City, N.Y.: Garden City Publishing Co., Inc., n.d. vol. 1, p. 142 Van's Gravesande, K.S. and Omran, H. (2005). Primary ciliary dyskinesia: cl inical presentation, diagnosis and genetics. Ann Med. 37:439 449 Vella, M. C., Choi, E.Y., Lin, S.Y., Reinert, K., Slack, F.J. (2004). The C. elegans microRNA let 7 binds to imperfect let 7 complementary sites from the lin 41 3'UTR. Genes Dev 18(2): 132 7. Wang S., Mitu, G.M., Hirschberg, R. ( 2008 ). Osmotic polyuria: an overlooked mechanism in diabetic nephropathy Nephrology Dialysis Transplantation 23(7):2167 2172 Watson J.D. and Crick F.H.C. ( 1953 ). A Structure for Deoxyribose Nucleic Acid Nature 171 737 738 Wheatley, D.N. (1969). Cilia in cell cultured fibroblasts: I. On their occurrence and relative frequencies in primary cultures and established cell lines. J Anat 105:351 362. Wong C.F. and Ross, T.L. ( 2008 ). MicroRNA 26a Targets the Histone Methyltransferase Enhancer of Zeste homolog 2 during Myogenesis J. Biol. Chem. 283(15): 9836 9843 Wu, L., Fan, J., Belasco, J.G (2006). MicroRNAs direct rapid deadenylation of mRNA. Proc Natl Acad Sci 103(11): 4034 9. Xiao, Z., Zhang, S., Mahlios J., Zhou, G., Magenheimer, B.S., Guo, D., Dallas, S.L., Maser, R., Calvet, J.P., Bonewald, L., Quarles, L.D. ( 2006 ). Cilia like structures and polycystin 1 in osteoblasts/osteocytes and associated abnormalities in skeletogenesis and Runx2 expression. J Biol Chem 281 : 30884 30895 Xu, T., Zhu, Y., Wei, Q.K., Yuan, Y., Zhou, F., Ge, Y.Y., Yang, J.R., Su, H., Zhuang, S.M. ( 2008 ). A functional polymorphism in the miR 146a gene is associated with the risk for hepatocellular carcinoma. Carcinogenesis 29: 2126 2131

PAGE 58

Yekta, S., Shih, I.H., Bartel, D.P (2004). MicroRNA directed cleavage of HOXB8 mRNA. Science 304 (5670): 594 6. Yi, R., Qin, Y., Macara, I.G., Cullen, B.R ( 2003 ). Exportin 5 mediates the nuclear export of pre microRNAs and short hairpin RNAs. Genes Dev 17: 3011 3016. Yoder, B.K. ( 2007 ). Role of Primary Cilia in the Pathogenesis of Polycystic Kidney Disease. J. Am. Soc. Nephrol. 18: 1381 1388 WEBSITE REFERENCES www.genome.ucsc.edu www.IDTDNA.com www.microrna.sanger.ac.uk/sequences www.Targetscan.org