ERROR LOADING HTML FROM SOURCE (http://ncf.sobek.ufl.edu//design/skins/UFDC/html/header_item.html)

Genetic Analysis of DRB and DQB from the Major Histocompatibility Complex in Narwhal and Humpback Whales

Permanent Link: http://ncf.sobek.ufl.edu/NCFE004724/00001

Material Information

Title: Genetic Analysis of DRB and DQB from the Major Histocompatibility Complex in Narwhal and Humpback Whales
Physical Description: Book
Language: English
Creator: Brosch, Jessica
Publisher: New College of Florida
Place of Publication: Sarasota, Fla.
Creation Date: 2013
Publication Date: 2013

Subjects

Subjects / Keywords: Major Histocompatibility Complex
Genetics
Marine Mammals
Narwhal, Humpback, Whales
Genre: bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: As the region of the genome coding for immunity against foreign pathogens, analysis of the major histocompatibility complex (MHC) class II loci DRB and DQB allow us to make predictions about the adaptive potential of the narwhal in its effort to evolve under pathogenic pressure. To assess potential vulnerability of species to pathogen exposure, I examined genetic variation in the MHC from two species, the narwhal and the Arabian Sea (Region X) Oman humpback whale. In the narwhal, at DQB, seven new alleles were identified, while at DRB eight new alleles were discovered. The DQB locus showed evidence of gene duplication and overall the narwhal exhibits moderate levels of diversity and statistical measures indicate population expansion. In the humpback whale subpopulation polymorphism and sequence variation from genomic and allelic sequences was analyzed in 28 humpbacks at the locus DQB. In these individuals, 16 new alleles were found and six individuals displayed copy number variation. These findings may indicate that this humpback subpopulation has undergone gene triplication as a genetic mechanism to artificially create increased diversity.
Statement of Responsibility: by Jessica Brosch
Thesis: Thesis (B.A.) -- New College of Florida, 2013
Electronic Access: RESTRICTED TO NCF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE
Bibliography: Includes bibliographical references.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The New College of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Local: Faculty Sponsor: Weber, Diana

Record Information

Source Institution: New College of Florida
Holding Location: New College of Florida
Rights Management: Applicable rights reserved.
Classification: local - S.T. 2013 B87
System ID: NCFE004724:00001

Permanent Link: http://ncf.sobek.ufl.edu/NCFE004724/00001

Material Information

Title: Genetic Analysis of DRB and DQB from the Major Histocompatibility Complex in Narwhal and Humpback Whales
Physical Description: Book
Language: English
Creator: Brosch, Jessica
Publisher: New College of Florida
Place of Publication: Sarasota, Fla.
Creation Date: 2013
Publication Date: 2013

Subjects

Subjects / Keywords: Major Histocompatibility Complex
Genetics
Marine Mammals
Narwhal, Humpback, Whales
Genre: bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: As the region of the genome coding for immunity against foreign pathogens, analysis of the major histocompatibility complex (MHC) class II loci DRB and DQB allow us to make predictions about the adaptive potential of the narwhal in its effort to evolve under pathogenic pressure. To assess potential vulnerability of species to pathogen exposure, I examined genetic variation in the MHC from two species, the narwhal and the Arabian Sea (Region X) Oman humpback whale. In the narwhal, at DQB, seven new alleles were identified, while at DRB eight new alleles were discovered. The DQB locus showed evidence of gene duplication and overall the narwhal exhibits moderate levels of diversity and statistical measures indicate population expansion. In the humpback whale subpopulation polymorphism and sequence variation from genomic and allelic sequences was analyzed in 28 humpbacks at the locus DQB. In these individuals, 16 new alleles were found and six individuals displayed copy number variation. These findings may indicate that this humpback subpopulation has undergone gene triplication as a genetic mechanism to artificially create increased diversity.
Statement of Responsibility: by Jessica Brosch
Thesis: Thesis (B.A.) -- New College of Florida, 2013
Electronic Access: RESTRICTED TO NCF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE
Bibliography: Includes bibliographical references.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The New College of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Local: Faculty Sponsor: Weber, Diana

Record Information

Source Institution: New College of Florida
Holding Location: New College of Florida
Rights Management: Applicable rights reserved.
Classification: local - S.T. 2013 B87
System ID: NCFE004724:00001


This item is only available as the following downloads:


Full Text

PAGE 1

i Genetic Analysis of DRB and DQ B from the Major Histocompatibility Complex in Narwhal and Humpback Whales BY JESSICA RAE BROSCH A Thesis Submitted to the Division of Natural Sciences New College of Florida In partial fulfillment of the requirements for the degree Bachelor of Arts in Biology Under the sponsorship of Diana Weber, Ph.D. Sarasota, Florida May, 2013

PAGE 2

ii TABLE OF CONTENTS LIST OF TABLES ................................................................................................... ......... iv LIST OF FIGURES ............................................................................. .................... .........v ABSTRACT ............ ............................................................................. ............................. .v i CHAPTER 1 INTRODUCTION ......................................................................................1 The Major Histocompatibility Complex. ........................... ............................... ......1 MHC and Disease ........................ ............................... ............................................. 3 MHC and Gene Duplication ....................................... ......... .................................... 4 The Narwhal ..................................................... ....................................................... 6 The Oman H T he purpose of this t hesis ........................... .................... ....... ..............................11 References...................................................................................... ..............................1 3 Introduction............................................................................. ...............................25 Materials and M ethods............................................................. .............. ................27 Results...................................................................................... ..............................28 Discussion..................................................................................................... .........30 References..................................................................................... ............................... 3 4 ..................... ........... ...................... ................... ........48 Introduction.............................................................................. ..............................49 Methods............................................................... ..................... ..............................53 Results...................................................................................... ..............................54 Discussion.................................................................................................. ........... 55 References........................................................................................ ................... .. .........58 CHAPTER 4 CONCLUSIONS .............................................................................. .. ....... 7 1 References..................................................................................... .... ... .........................7 4

PAGE 3

iii APPENDIX 1 Cellular C ontext of the MHC ..................................... ............................ 76 References............................................................................... ............................... 80 Figure 1 Ch romosom e mapping................................ ................................81 Figure 2. 3D structure of Class I I molecule ............... ................................ 82 Figure 3. Cellular contex t of MHC...................................... ......................83 APPENDIX 2 Narwhal DQB New Allele Sequences ................................................................. 84 APPENDIX 3 Narwhal DR B New Allele Sequences ............................................ ......................85 APPENDIX 4 Humpback DQB Ne w Allele Sequences ..................................................... ........ 86

PAGE 4

iv LIST OF TABLES CHAPTER 2 Table 1. Genetic Diversity Indices for Narwhal DRB and DQB .. Table 2 (a). Narwhal DQB ............... 39 Table 2 (b). Narwhal DQB ......................... ... 39 Table 3. Narwhal DQB ......... 40 Table 4. Narwhal DRB ............ .. 41 Table 5. Narwhal DRB ..... 42 CHAPTER 3 Table 1 Humpback DQB Variability... Table 2. Humpback Published DQB A .... 63 ............................... 64 ............ 65

PAGE 5

v LIST OF FIGURES CHAPTER 3 ............................. 66 ................................. 67 Figure 3. Amino acid variation in class II of the MHC in DQB genotypes of the .................................................................................................. Figure 4(a) Chromatogram for Individual OM01_012 showing polymor phic site at base ...................................................... 69 Figure 4 (b). Chromatogram for Individual OM01_012 showing 14 c ... 69 ..... 7 0

PAGE 6

vi Genetic Analysis of DRB and DQ B from the Major Histocompatibility Complex in Narwhal and Humpback Whales Jessica Rae Brosch New College of Florida, 2 013 ABSTRACT As the region of the genome coding for immunity against foreign pathogens, analysis of the major histocompatibility complex (MHC) class II loci DRB and DQB allow us to make predictions about the adaptive potential of the narwhal in its effort to evolve under pathogenic pressure. To assess potential vulnerability of species to pathogen exposure I examined genetic variation in the MHC from two species, the na rwhal and the Arabian Sea (Region X) Oman humpback whale. In the narwhal, a t DQB seven new alleles were identified, while at DRB eight new alleles were discovered. The DQB locus showed evidence of gene duplication and o verall the narwhal exhibits moderat e levels of diversity and statistical measures indicate population expansion. In the humpback whale subpopulation p olymorphism and sequence variation from genomic and allelic sequences was analyzed in 28 humpbacks at the locus DQB. In these individuals, 16 new alleles were found and six individuals displayed copy number variation These findings may indicate that this humpback subpopul ation has undergone gene triplication as a genetic mechanism to artificially create increased diversity. _______________________ Diana Weber, Ph. D.

PAGE 10

Painter & Stern 2012

PAGE 12

The Narwhal

PAGE 14

1 1 A stock is a management term that refers to a group of individuals from the same species or subpopulation viewed independently for research and management purposes.

PAGE 19

Acevedo Whitehouse K, Cunningham AA. (2006). Is MHC enough for understanding immunogenetics? Trends in Ecology and Evolution 21: 433 438. Arkush K, Giese A, Mendonca H, McBride A, Mary G, Hedrick P. Resistance to three pathogens in the endangered winter run chinook salmon (Oncorhynchus tshawytscha): effects of inbreeding and major histocompatibility complex genotypes. Can. J. F ish. Aquat. Sci. 2002; 59: 966 975. Baker C, Medrano Gonzalez L, Calambokidis J, Perry A, Pichler G, Rosenbaum H, Straley JM, Urban Ramirez J, Yamaguchi M, Von Ziegesar O. Population structure of nuclear and mitochondrial DNA variation among humpback wha les in the North Pacific. Molecular Ecology (1998) 7, 696 707. Baker C, Clapham P. Modelling the past and future of whales and whaling. 2004. Trends in ecology and evolution 19:356 371. y and duplication of DQB and DRB like genes of the MHC in baleen whales (suborder: Mysticeti). Immunogenetics 2006. 58: 283 296. Barribeau S, Villinger J, Waldman B. Major Histocompatibility Complex Based Resistance to a Common Bacterial Pathogen of Amphi bians. PloS ONE 2008; 3(7): e2692. Doi:10.1371/journal.pone.0002692. Bayley JP, Ottenhoff TH, Verweij CL. Is there a future for TNF promoter polymorphisms?. Genes Immun 2004; 5:315 29. Benacerraf, B. Role of MHC gene products in immune regulation. Scienc e 1981; 212: 1229 38. Born, E. W., Heide Jrgensen, M. P., Larsen, F. and Martin, A. R. 1994. Abundance and stock composition of narwhals ( Monodon monoceros ) in Inglefield Bredning (NW Greenland). Meddelelser om Gronland Bioscience 39: 51 68. Bowen, L., Aldridge, B.M., Gulland, F.,Van Bonn, W., DeLong, R., Melin, S., Lowenstine, L.J., Stott, J.L., & Johnson, M.L. (2004) Class II multiformity generated by variable MHC DRB region configurations in the California sea lion (Zalophus californianus). Immunogene tics 56, 12 27. C erchio S, P omilla C, E rsts P, R azafindrakoto Y, L eslie M, A ndrianrivelo N, C ollins T, D ushane J, M urray A, W eber D, R osenbaum H. Estimation of abundance of breeding stock C3 of humpback whales, assessed through photographic and genotypic mark recapture data from Antongil Bay, Madagascar. SC/AO6/HW9.

PAGE 20

Codner GF Birch J Hammond JA Ellis SA Constraints on haplotype structure and variable gene frequencies suggest a functional hierarchy within cattle MHC class I. Immu nogenetics 2012 Jun;64(6):435 45. Dausset J. The major histocompatibility complex in man. Science 1981; 213: 1269 74. de March B, Stern G. Stock separation of narwhal (Monodon monoceros) in Canada based on organochlorine contaminants. (2003) Canadian S cience Advisory Secretariat. Research Document 2003/079. DFO. 2011. Advice regarding the genetic structure of Canadian narwhal ( Monodon monoceros ). DFO Can. DFO Can. Sci. Advis. Sec. Sci. Advis. Rep 2011/021. Doxiadis, G.G.M., Rouweler, A.J.M., de Groo t, N.G., Louwrese, A., Otting, N., Verschoor, E.J., Bontrop, R.E. (2006) Extensive sharing of MHC class II alleles between rhesus and cynomolgus macaques. Immunogenetics 58, 259 268. Eimes JA Bollmer JL Whittingham LA Johnson JA VAN Oosterhout C Dunn PO Rapid loss of MHC class II variation in a bottlenecked population is explained by drift and loss of copy number variation. J Evol Biol 2011 Sep ; 24 (9):1847 56. Food and Agriculture Organization of the United Nations. 2007. The state of world fisheries and aquaculture 2006. FAO, Rome, Italy. recapture using microsatellite genotyping confirm low abundance and reproductive autonomy of humpback whales o n the wintering grounds of New Caledonia. Marine Ecology Progress Series 2004. 274: 251 262. Hartl, Daniel L., and Maryellen Ruvolo. Genetics: Analysis of Genes and Genomes 8th ed. Burlington, MA: Jones & Bartlett Learning, 2012. Print. Hedrick PW, Kim TJ. (2000). Genetics of complex polymorphisms: parasites and maintenance of the major histocompatibility complex variation. In: Evolutionary Genetics: Molecules to Morphology eds. Singh RS, Krimbas CK. Cambridge Univ. Press, New York. Heide Jrgensen, M. P. and Dietz, R. 1995. Some characteristics of narwhal, Monodon monoceros diving behaviour in Baffin Bay. Canadian Journal of Zoology 73: 2106 2119. Hill A, Allsopp C, Kwiatkowski D, Anstey N, Twumasi P, Rowe P, Bennett S, Brewster D, McMichael A, Green wood B. Common West African HLA antigens are associated with protection from severe malaria. Nature 1991; 352: 595 600.

PAGE 21

Hoover C, Bailey M, Higdon J, Ferguson S, Sumaila R. Estimating the Economic Value of Narwhal and Beluga Hunts in Hudson Bay, Nunavut. (2013 ) Arctic Institute of North America 66. Horton R, Wilming L, Rand V, Lovering R, Bruford E, Khodiyar V, Lush M, Povey S, Talbot C, Wrigth M, Wain H, Trowsdale J, Ziegler A, Beck S. Gene map of the Extended Human MHC. Nature Reviews Genetics 2004; 5: 889 899. Innes, S., Heide Jrgensen, M. P., Laake, J. L., Laidre, K. L., Cleator, H. J., Richard, P. and Stewart, R. E. A. 2002. Surveys of belugas and narwhals in the Canadian High Arctic in 1996. NAMMCO Scientific Publications 4: 169 190. Internati onal Whaling Commission. 2005. Report of the subcommittee on other Southern Hemisphere whale stocks. Journal of Cetcaean Research and Management 7: 235 253. International Whaling Commission. 2007. Report of the Scientific Committee. Journal of Cetcaean Re search and Management 9: 1 73. Jeffery, K. J. M., Bangham, C. R M. Do infectious diseases drive MHC diversity? Microbes Infect 2000; 2: 1335 1341. Johnson, A., Salvador, G., Kenney, J., Robbins, J., Kraus, S., Landry, S. and Clapham, P. 2005. Fishing gear involved in entanglement of right and humpback whales. Marine Mammal Science 21: 635 645. Kamath PL, Getz WM. (2011). Adaptive molecular evolutio n of the Major Histocompatibility Complex genes, DRA and DQA, in the genus Equus. BMC Evolutionary Biology 11:128. doi:10.1186/1471 2148 11 128. Mhc evolution. In Progress in Immunology e d. J Gergely, pp. 137 43. Budapest: Springer Klein J, Huigin C. 1994. MHC Polymorphism and Parasites. Philosophical Transactions: Biological Sciences 346: 351 358. Laidre, K. L., Heide Jrgensen, M. P., Jorgensen, O. A. and Treble, M. A. 2004. Deep ocean predation by a high Arctic cetacean. ICES Journal of Marine Science 61: 430 440. Laidre, K. L. and Heide Jrgensen, M. P. 2005. Winte r feeding intensity of narwhals ( Monodon monoceros ). Marine Mammal Science 21(1): 45 57. Laidre, K. L., Stirling, I., Lowry, L.F., Wiig, ., Heide Jrgensen, M. P. and Ferguson, S.H. 2008. Quantifying the sensitivity of Arctic marine mammals to climate in duced habitat change. Ecological Applications 18 (Supplement: Arctic Marine Mammals): 97 125.

PAGE 22

Lenz TL. (2011). Computational prediction of MHC II antigen binding supports divergent allele advantage and explains trans species polymorphism. Evolution 65: 2 380 2390. Mayer, F. & Brunner, A. (2007) Non neutral evolution of the major histocompatibility complex class II gene DRB 1 in the sac winged bat Saccopteryx bilineata. Heredity 99, 257 264.McCallum H, Kuris A, Harvell C, Lafferty K. Does terrestrial epidemiology apply to marine systems? 2004 Tren ds in Ecology 19: 585 591. Ministry of Agriculture and Fisheries. 2002. In: Fisheries Statistical Year Book 2001 Muscat, Oman. Ministry of National Economy. 2003. Statistical Yearbook, August 2003. Muscat, Oman. Minton G, Collins T, Pomilla C, Findlay K, Rosenbaum H, Baldwin R, Brownell Hr R. 2008 Megaptera novaengliae (Arabian Sea subpopulations) In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2 Mitchell, E. and Reeves, R. R. 1981. Catch history and cumulativ e catch estimates of inital population size of cetaceans in the eastern Canadian Arctic. Reports of the International Whaling Commission 31: 645 682. Murray BW, Malik S, White BN. Sequence variation at the major histocompatibility complex locus DQ beta in beluga whales (Delphinapterus leucas). Mol Biol Evol 1995 Jul; 12(4): 582 93. Murray BW, White BN. Sequence variation at the major histocompatibility complex DRB loci in beluga (Delphinapterus leucas) and narwhal (Monodon monoceros). Immunogenetics 199 8 Sep; 48(4): 242 52. Nielsen M, Lund O, Buus S, Lundegaard C. MHC Class II epitope p redictive algorithms. Immunology 2010 July; 130(3): 319 328. North Atlantic Marine Mammal Commission. 2005. Report of the Joint Meeting of the NAMMCO Scientific Committee Working Ground on the population status of narwhal and beluga in the North Atlantic and the Canada/Greenland Joint Commission on Consercation and Management of Narwhal and Beluga Scientific Working Group. North Atlantic Marine Mammal Commission, Nuuk, Greenland. O lovarria C, P oole M, H auser N, G arrigue C, C aballero S, R asseur M, M artien K, R ussell K, O remus M, D odemont R, F lorez Gonzalez L, C apella J, R osenbaum H, M oro D, J enner C, J enner M, B annister J, Baker CS. Population differentiation of humpback whales from far Polynesia (Group F breeding grounds) based on mitochondrial DNA sequences. 2004. For consideration by the Scientific Committee of the IWC, Berlin, Germany.

PAGE 23

Oliver M, Telfer S, Piertney S. Major histocompatibility complex (MHC) heterozygote superiority to natural multi parasite infections in the water vole (Arvicola t errestris). Proc. R. Soc. B. 2009; 276: 1119 1128. Painter CA, Stern LJ. Conformational variation in structures of classical and non classical MHCII proteins and functional implications. 2012 Immunol Rec 250(1):144 157. Palsbll J, Heide Jrgensen MP, Dietz R. Population structure and seasonal movements of narwhals, Monodon monoceros determined from mtDNA analysis. (1997) 78; 284 292. Petersen, S.D., Tenkula, D. and Ferguson, S.H. 2011. Population Genetic Structure of Narwhal ( Monodon monoceros ). DFO Can. Sci. Advis. Sec. Res. Doc 2011/021. vi + 20 p. Piertney SB, Oliver MK. (2006). The evolutionary ecology of the major histocompatibility comp lex. Heredity 96: 7 21. Pomilla C, Rosenbaum H. Estimates of relatedness in groups of humpback whales (Megaptera novaengliae) on two wintering grounds of the Southern Hemisphere. 2006. Molecular Ecology 15, 2541 2555. Pomilla C, Collins T, Minton G, Fi ndlay K, Matthew LS, Ponnampalam L, Baldwin R, Rosenbaum H. Genetic distinctiveness and decline of a small population of humpback whales (Megaptera novaengliae) in the Arabian Sea (Region X). 2010. SC/62/SH6. Reilly, S.B., Bannister, J.L., Best, P.B., Br own, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbn, J. & Zerbini, A.N. 2008. Megaptera novaeangliae In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. < www.iucnredlist.org >. Downloaded on 30 Ap ril 2013 Reinhardt Nielsen M, Meilby H. Quotas on Narwhal (Monodon monoceros) Hunting in Regulations on Inuit Communities. (2013) Human Ecology 41; 2: 187 203. Rosenbaum H, Wenr ich M, Stoleson S, Gibbs J, Baker C, DeSalle R. The effect of differential reproductive success on population genetic structure: Correlations of Life History with Matrilines in Humpback Whales of the Gulf of Maine. 2002 American Genetic Association 93: 38 9 399. Rosenbaum HC Pom illa C Mendez M Leslie MS Best PB Findlay KP Minton G Ersts PJ Collins T Engel MH Bonatto SL Kotze DP Meer M Barendse J Thornton M Razafindrakoto Y Ngouessono S Vely M Kiszka J Population structure of

PAGE 24

humpback whales from their breeding grounds in the South Atlantic and Indian Oceans. PLoS One 2009 Oct 8;4(10):e7318 Savidge, G., Lennon, J. and Matthews, A.J. 1990. A shore based survey of upwelling along the coast of Dhofar region, southern Oman. Continental Shelf Research 10(3): 259 275. Saxena, K., Kitzmiller, K.J., Wu, Y.L., Zhou, B., Esack, N., Hiremath, L., Chung, E.K., Yang, Y. & Yu, C.Y. (2009) Great genotypic and phenotypic diversities associated with copy number variations of complement C4 and RP C4 CYP21 TNX (RCCX) modules: A comparison of Asian Indian a nd European American populations. Mol Immunol 46, 1289 1303. Sidow A. Gen(om)e duplications in the evolution of early vertebrates. Curr Opin Genet Dev 1996; 6:715 22. Siddle HV, Marzec J, Cheng Y, Jones M, Belov K. (2010). MHC gene copy number variatio n in Tasmanian devils: Implications for the spread of a contagious cancer. Proc. R Soc. B 277: 2001 2006. Slade R. Limited MHC polymorphism in the Southern Elephant Sea: Implicatinos for MHC Evolution and Marine Mammal Population Biology. 1992 Proc R Soc B 249(1325) 163 171. Sommer S. (2005). The importance of immune gene variability (MHC) in evolutionary ecology and conservation. Frontiers in Zoology 2: 16. Tanaka Matsuda M Ando A Rogel Gaillard C Chardon P Uenishi H Difference in number of loci of swine leukocyte antigen classical class I genes among haplotypes. Genomics. 2009 Mar ; 93 (3):261 73. Trowsdal e J, Groves V, Arnason A. Limited MHC polymorphism in whales. 1989. Immunogenetics 28:19 24. Trowsdale J. Both man and bird and beast: comparative organization of MHC genes. Immunogenetics 1995; 41:1 17. Trowsdale, J. (2011) The MHC, disease and selectio n. Immunol. Lett 137, 1 8. Vandiedonck C, Beaurain G, Giraud M, et al. Pleiotropic effects of the 8.1 HLA haplotype in patients with autoimmune myasthenia gravis and thymus hyperplasia. Proc Natl Acad Sci USA 2004; 101:15464 9. Vandiedonck C, Knight JC. The human Major Histocompatibility Complex as a paradigm in genomics research. Briefings in Functional Genom and Proteomics 2009; 8: 379 394.

PAGE 25

Volgenau, L., Kraus, S.D. and Lien, J. 1995. The impact of entanglements on two substocks of the western North A tlantic humpback whale, Megaptera novaeangliae Canadian Journal of Zoology 73: 1689 1698. Waltzek TB Corts Hinojosa G Wellehan JF Jr Gray GC Marine mammal zoonoses: a review of disease manifestations Zoonoses Public Health 2012 Dec ; 59 (8):521 35 We ber DS, Stewart BS, Garza JC, Lehman N (2000) An empirical genetic assessment of the severity of the northern elephant seal population bottleneck. Current Biology 10 1287 1290. Weber, D. S., Van Coeverden De Groot, P. J., Peacock, E., Schrenzel, M. D., Perez, D. A., Thomas, S., Shelton, J. M., Else, C. K., Darby, L. L., Acosta, L., Harris, C., Youngblood, J., Boag, P. and Desalle, R. (2013), Low MHC variation in the polar bear: implications in the face of Arctic warming?. Animal Conservation. doi: 10.111 1/acv.12045 Whitteveen R, Staley J, Von Ziegesar O, Steel D, Baker S. Abundance and mtDNA differentiation of humpback whales (Megaptera novaengliae) in the Shumagin Islands, Alaska. (2004 ) Can J Zool 82: 1352 1359. Yang, G., Yan, J., Zhou, K. & Wei, F. (2005) Sequence variation and gene duplication at MHC DQB loci of baiji (Lipotes vexillifer), a Chinese River dolphin. J Heredity 96, 310 317. Yang, Y. et al. (2007) Gene copy number variation and associated polymorphisms of complement component C4 in hu man systemic lupus erthematosus (SLE): low copy number is a risk factor for and high copy number is a protective factor against SLE susceptibility in European Americans. Am J Hum Genet 80, 1037 1054.

PAGE 28

Figure 3 Humpback Whale Range and Breeding Stocks Map showing a selection of the humpback breeding stocks. This map shows breeding stocks A (off the coast of Brazil), B (off the coast of West Africa), C (off the coast of East Africa and Madagascar) and X (off the coast of Oman in the Arabian Sea). (Taken from Pomilla et al., 2010)

PAGE 29

Figure 4. Map of breeding stock X. This map shows a close up of the Gulf of Oman, shown in white, with Iran to the North and Oman bordering to the Southwest. (Taken from Pomilla et al., 2010)

PAGE 30

Many fields in biology seek to assess risks to species health associated with climate change. As an Arctic marine mammal, the narwha l is at high risk of habitat loss due to melting sea ice. Cold Arctic waters previously restricted pathogens from the narwhal habitat. However, warming ocean temperatures will allow the introduction of novel pathogens against which the narwhal may lack suf ficient diversity to recognize as non self. One method to assess the diversity of a species is genetic analysis of the major histocompatibility complex (MHC). As the region of the genome coding for immunity against foreign pathogens, analysis of Class II l oci DRB and DQB allow us to make predictions about the adaptive potential of the narwhal in its effort to evolve under pathogenic pressure. The narwhal was examined for polymorphism and sequence variation using genomic sequence data. At DQB seven new all eles were identified, while at DRB eight new alleles were discovered. The DQB locus showed eight individuals with three alleles each, providing evidence of gene duplication. Overall, the narwhal exhibits moderate levels of diversity and statistical measure s indicate population expansion.

PAGE 31

Introduction The narwhal ( Monodon monoceros ) is an arctic marine mammal, whose distribution ranges in the Atlantic Arctic around Northeast Canada and Greenland (Figure 1). Killer whales ( Orcinus orca ) and polar bears ( Ur sus maritimus ) prey on narwhals but their main threat to survival is loss of habitat secondary to melting sea ice (Smith & Sjare 1989). In addition, with less sea ice acting as a barrier, it is predicted that shipping traffic into Arctic waters will increa se (Wilson et al., 2004). For these reasons, MHC studies have been used to assess the genetic variability of the narwhal in the face of these threats.

PAGE 32

With this background information in mind, this study focused on examining a greater sample of narwhal DNA from both the DQB and DRB loci. This analysis has conservation implications wh ich can be used to evaluate the species diversity, examine evolutionary changes and make recommendations regarding their hunting status. The current study hypothesizes that the narwhal may have limited MHC diversity given its lack of exposure to many patho gens in the Arctic habitat.

PAGE 33

Materials and Methods

PAGE 34

Results The narwhal showed moderate variation in the peptide bind ing region (PBR) in exon 2 for both of the MHC class II loci, DQB and DRB surveyed in this study. Examination of the sequences revealed many sites with secondary peaks, suggesting that these individuals were heterozygous (Figure 4). There were 28 individu als homozygous for Momo DQB*0201 and one individual homozygous for Momo DQB*0203 I analyzed 81 narwhal individuals and found seven new DQB alleles (Table 3) (Appendix 2 ) and 32 individuals matched the published DQB allele (Murray et al., 1995). Of these, 28 individuals were homozygous for the most prominent allele, Momo DQB 0201 which was found by Murray et al. (1995) and the next most prominent allele which I discovered, Momo DQB 0205 was found in 16 individuals (Table 2). I determined 22 individuals to be heterozygous (Table 3). The heterozygote genotypes included two individuals with alleles Momo DQB*0201 and Momo DQB*0203 two individuals with alleles Momo DQB*0201 and Momo DQB*0204 six individuals with alleles Momo DQB*0204 and Momo DQB*0205 and f our individuals with alleles Momo DQB*0205 and Momo DQB*0207 In addition, I found eight individuals with three different alleles indicating two DQB genes present in these narwhals: two individuals had Momo DQB*0203/ Momo DQB*0204/ Momo DQB*0206 and six in dividuals had alleles Momo DQB*0205 Momo DQB*0207 and Momo DQB* 0208 (Table 3). Distinguishing from the other alleles, Momo DQB 0202 shows a deletion at a single base pair which was found in two haplotypes (Table 3). This was the least prevalent allele i n this sample. Unlike DQB none of the previously published DRB alleles were found in the 41 individuals were examined this study (Table 4). I found eight new DRB alleles the

PAGE 35

sequences of which can be found in Appendix 3 (Table 4) all of which were in t he heterozygous condition. I found none of the published alleles DRB 0101 DRB 0102 and DRB 0103 (Murray & White 1998). Investigating the genotypic condition, twenty six individuals showed the most prevalent genotype, DRB*0104 and DRB*0105 that differed at only one site in the PBR at base pair 5 (Table 5). There were 6 individuals heterozygous for alleles DRB 0104 and DRB 0110 Four individuals were heterozygous for DRB 0106 and DRB 0107 Three were heterozygous for DRB*0104 and DRB*0111 Two individuals we re heterozygous for DRB 010 8 and DRB 0109 (Table 5). Nucleotide diversity ( ) was greater for DQB [0.0426] than for DRB [0.01155] (Table 1). Gene diversity was greater for DQB [0.7753] than for DRB [0.7510] however D (Tajima 1993) was slightly negative at both loci [ DQB = 1.05; DRB = 0.526 ] though not significant ( P > 0.10 Fs (Fu 1997) was negative and somewhat similar for both loci [ DQB = 2.96; DRB = 5.95]. Other statistical measures tested for included were also determined for both loci including average number of nucleo tide differences ( k ) which was 7.11 in DQB and 2.75 in DRB (Table 1). At DQB the expected number of alleles [9.79586] was greater than observed while at DRB the observed was greater than expected [6.34044] (Table 1). The Ewens Watterson test for observe d levels of homozygosity were lower than expected in both DRB and DQB (Ewens 1972; Watterson 1978) (Table 1). The ratio of nonsynonymous to synonymous substitutions were examined in DQB and DRB showing greater amounts of nonsynonymous substitutions in both loci, 2.84 in DQB and 3.13 in DRB (Table 1).

PAGE 40

References of DQB and DRB like genes of the MHC in baleen whale s (suborder: Mysticeti). Immunogenetics 2006. 58: 283 296. Bowen, L., Aldridge, B.M., Gulland, F.,Van Bonn, W., DeLong, R., Melin, S., Lowenstine, L.J., Stott, J.L., & Johnson, M.L. (2004) Class II multiformity generated by variable MHC DRB region configu rations in the California sea lion (Zalophus californianus). Immunogenetics 56, 12 27. Doxiadis, G.G.M., Rouweler, A.J.M., de Groot, N.G., Louwrese, A., Otting, N., Verschoor, E.J., Bontrop, R.E. (2006) Extensive sharing of MHC class II alleles between rhesus and cynomolgus macaques. Immunogenetics 58, 259 268. Ewens WJ. (1972). The sampling theory of selectively neutral alleles. Theor. Popul. Biol. 3: 87 112. Excoffier, L. and H.E. L. Lischer (2010) Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources. 10: 564 567. Goda,N., Mano,T., Kosintsev,P., Vorobiev,A. and Masuda, R. Allelic diversity of the MHC class II DRB genes in brown bears (Ursus arctos) and a comparison of DRB sequences within the family Ursidae. Tissue Antigens 76 (5), 404 410 (2010) H eide J orgensen MP, D ietz R, L aidre KL, N icklen P, G arde E, R ichard P and O rr J. Resighting of a Narwhal (Monodon monoceros) Instrumented with a Satellite Transmitter. A rctic Vol 61, N o 4 (D ecember 2008) P. 395 398. Heide Jrgensen MP, Richard PR, Dietz R & Laidre KL. A metapopulation model for Canadian and West Greenland n arwhals. Animal Conservation 2012 Print ISSN 1367 9430.

PAGE 41

International Whaling Commission. 2007. Report of the Scientific Committee. Journal of Cetcaean Research and Management 9: 1 73. Kelly JK A test of neutrality based on interlocus associations Gene tics 1997 Jul; 146(3):1197 206. Mayer, F. & Brunner, A. (2007) Non neutral evolution of the major histocompatibility complex class II gene DRB 1 in the sac winged bat Saccopteryx bilineata. Heredity 99, 257 264.McCallum H, Kuris A, Harvell C, Laf ferty K. Does terrestrial epidemiology apply to marine systems? 2004 Trends in Ecology 19: 585 591.

PAGE 42

Saxena, K., Kitzmiller, K.J., Wu, Y.L., Zhou, B., Esack, N., Hiremath, L., Chung, E.K., Yang, Y. & Yu, C.Y. (2009) Great genotypic and phenotypic diversities associated with copy number variations of complement C4 and RP C4 CYP21 TNX (RCCX) modules: A comparison of Asian Indian and European American populations Mol Immunol 46, 1289 1303.

PAGE 43

Weber, D.S., Stewart, B.S., Schienman, J. & Lehman, N. (2004) Major histocompatibility complex variation at three class II loci in the northern elephant seal. Mol. Ecol. 1 3 711 718. Weber, D. S., Van Coeverden De Groot, P. J., Peacock, E., Schrenzel, M. D., Perez, D. A., Thomas, S., Shelton, J. M., Else, C. K., Darby, L. L., Acosta, L., Harris, C., Youngblood, J., Boag, P. and Desalle, R. (2013), Low MHC variation in the polar bear: implications in the face of Arctic warming?. Animal Conservation doi: 10.1111/acv.12045 W illiams TM, N oren SR, G lenn M. Extreme physiological adaptations as predictors of climate change sensitivity in the narwhal, Monodon monoceros. 2010. M arine M ammal S cience Wilson, K.J., Falkingham, J., Melling, H., De Abreu. R. Shipping in the Canadian Arctic: other possible climate change scenarios. Geoscience and Remote Sensing Symposium, 2004. IGARSS '04. Proceedings. 2004 IEEE International (Volume : 3) 1853 1856. Yang, G., Yan, J., Zhou, K. & Wei, F. (2005) Sequence variation and gene duplication at MHC DQB loci of baiji (Lipotes vexillifer), a Chinese River dolphin. J Heredity 96, 310 317.

PAGE 44

Table 1. Genetic Diversity Indices for Narwhal DRB and DQB 1 Fu 1997 2 Tajima 1993 3 Kelly 1997 4 Chakraborty 1990 5 Ewens 1972; Watterson 1978

PAGE 45

Table 2 (a). Narwhal DQB Allele Frequencies Alleles published by Murray et al., 1995 are indicated by superscript 1 Allele Name Freq by Individual Prevalence Rank Momo_ DQB *0201 1 32 1 Momo_ DQB *0202 1 7 Momo_ DQB *0203 4 5 Momo_ DQB *0204 10 3 Momo_ DQB *0205 16 2 Momo_ DQB *0206 2 6 Momo_ DQB *0207 10 3 Momo_ DQB *0208 6 4 Table 2 (b). Narwhal DQB Polymorphic Sites Allele Name 1 4 17 18 1 9 2 9 5 1 5 2 5 7 6 6 8 0 1 0 3 1 0 8 1 0 9 1 1 0 1 1 1 1 1 5 1 2 4 1 2 8 1 2 9 1 3 0 1 4 3 1 5 4 1 6 4 DQB 0201 1 C G C T C T A C G G T C G G A C C G A G C C A C DQB 0202 C G C T C T T A A G T C G G A C G A G C C A C DQB 0203 C G G G T T A C G G T C G G A C C G A G C C A C DQB 0204 C G C T C T A C G G C C G G A C C G A G C C A C DQB 0205 C G C T C T A C G G T G C G A C C G C G C C A C DQB 0206 G A C T C C A C G G T C C G A C C G A G C C A C DQB 0207 C G G G T T A C G G C G G C A T T C A G C C A G DQB 0208 G G C T C C A C G A T C G G G C C C A A G A G C

PAGE 46

Table 3. Narwhal DQB Individual Allelic Composition Alleles followed by the supersc ript 1 indicate alleles published by Murray et al., 1995. # of Individuals Heterozygote or Homoz ygo te Allele Name 28 homo DQB*0201 1 1 homo DQB*0202 2 hetero DQB*0201, DQB*0203 2 hetero DQB*0201, DQB*0204 6 hetero DQB*0204, DQB*0205 2 hetero DQB*020 3, DQB*0204, DQB*0206 4 hetero DQB*0205, DQB*0207 6 hetero DQB*0205, DQ B *0207, DQB*0208

PAGE 47

Table 4. Narwhal DRB Allele Frequencies Alleles followed by the superscript 1 indicate alleles published by Murray & White, 1998. Allele Name Individual freq uency Prevalence Rank DRB*0101 1 0 DRB*0102 1 0 DRB*0103 1 0 DRB*0104 35 1 DRB*0105 26 2 DRB*0106 4 4 DRB*0107 4 4 DRB*0108 2 6 DRB*0109 2 6 DRB*0110 6 3 DRB*0111 3 5

PAGE 48

Table 5. Narwhal DRB Genotypes, Alleles and Polymorphic Sites Individual Allele Name 2 3 5 1 3 2 3 5 2 20 8 20 9 21 0 21 5 23 3 8215 C C R A G C G T G G T 1195 C C R A G C G T G G T 1181 C C R A G C G T G G T 108 C C R A G C G T G G T 11072 C C R A G C G T G G T 11075 C C R A G C G T G G T 11082 C C R A G C G T G G T 11120 C C R A G C G T G G T 11125 C C R A G C G T G G T 11124 C C R A G C G T G G T 11129 C C R A G C G T G G T 11132 C C R A G C G T G G T 11102 C C R A G C G T G G T 11140 C C R A G C G T G G T 11080 C C R A G C G T G G T 114 C C R A G C G T G G T 21094 C C R A G C G T G G T 21100 C C R A G C G T G G T 1063 C C R A G C G T G G T 1064 C C R A G C G T G G T 1062 C C R A G C G T G G T 1061 C C R A G C G T G G T 1199 C C R A G C G T G G T 9209 C C R A G C G T G G T 1187 C C R A G C G T G G T 9212 C C R A G C G T G G T DRB*0104 C C A A G C G T G G T DRB*0105 C C G A G C G T G G T 11147 C C R A G C K W S G G 11150 C C R A G C K W S G G 1207 C C R A G C K W S G G 9223 C C R A G C K W S G G DRB*0106 C C A A G C G T G G G DRB*0107 C C G A G C T A C G G 109 C C R A G C G T G A T 111 C C R A G C G T G A T DRB*0108 C C A A G C G T G A T DRB*0109 C C G A G C G T G A T

PAGE 49

Table 5. Narwhal DRB Genot ypes, Alleles and Polymorphic Sites continued 11068 C C R A R S G T G G T 11078 C C R A R S G T G G T 11117 C C R A R S G T G G T 11121 C C R A R S G T G G T 1198 C C R A R S G T G G T 9210 C C R A R S G T G G T DRB*0104 C C A A G C G T G G T DRB*0110 C C G A A G G T G G T 11142 C C R A G C G T G G K 21106 C C R A G C G T G G K 1184 C C R A G C G T G G K DRB*0104 C C A A G C G T G G T DRB*0111 C C G A G C G T G G G

PAGE 51

Dots (.) mark identity with top sequence. Dashes ( ) indicate lack of data. Asterisks (*) indicate the peptide binding region as determined by Brown et al., 1993. (a) DQB * MomoDQB*0201 TERVRLVSRY IYNREEYVRF DSDVGEYRAV TELGRRTAEY WNSQKDILER TRAELDT MomoDQB*0202 .......... ......L.H. .......... .......PST GTARRTSWSG HGPSWT MomoDQB*0203 .....G.... .......... .......... .......... .......... ....... MomoDQB*0204 .......... .......... ......H... .......... .......... ....... MomoDQB*0205 .......... .......... .......... .....P.... ..R....... ....... MomoDQB*0206 ... ......H .......... .......... .....P.... .......... ....... MomoDQB 0207 .....G.... .......... ......H... ......I... C......... ....V.. MomoDQB* 0208 .........H .......... .N........ ......A... C.K....M.. ....... DeleDQB*0103 .......... ......L.H. ...... .... .....PD... .......... ...K... Dele DQB* 0201 .......T.. .......... .......... .......... .......... .....E. DeleDQB*0202 .......T.. .......... .......... .......... .......... ....... CeheBP02DQB*1 .....F.N.. ......F... ....DDF... .......... ......... K...... Meno DQB*1c .......V. H ...... FA .. .......... .....PS.K. ......L.. Q ....... MianDQB NES1 .....V.T.D ......F... ........P. ..... PF ... ---------------

PAGE 52

Figure 3. Amino acid variation and alignment of DRB This alignment compares the amino acids found in all known narwhal DRB alleles with beluga ( Delphinaru pte s leucas ) (Murray and White, 1998), polar bear ( Ursus maritimus dolphin ( Cephalorhynchus hectori ) (Baker et al., 2006). (b)DRB ** MomoDRB*0101 YQFKGECRFS NGTERVRLVT RHIYNEEEFM RYDSDVGECR AVTELGRRTA MomoDRB*0102 .......... .......... .......... .......... .......... MomoDRB*0103 .......H.. .......V.. .......... .......... .. ........ MomoDRB*0104 S...S..... .......... .......... .......... .......... MomoDRB*0105 SR..S..... .......... .......... .......... .......... MomoDRB*0106 S...S..... .......... .......... .......... .......... MomoDRB*0107 SR..S..... ... ....... .......... .......... .......... MomoDRB*0108 S...S..... .......... .......... .......... .......... MomoDRB*0109 SR..S..... .......... .......... .......... .......... MomoDRB*0110 SR..S..H.. .......V.. .......... .......... .......... MomoDRB*0111 SR..S..... .......... .......... .......... .......... DeleDRB*0101 .......... .......... .....G.... .......... .......... DeleDRB*0102 .......... .......... .....G.... .......... .......... DeleDRB*0201 L.L.A..... .......... .....G. ... .......... .......... DeleDRB*0202 L.L.A..... .......... .....G.... .......... .......... DeleDRB*0301 .......... .......... .D...G..YV ........Y. .......PD. DeleDRB*0401 FR..S..... ......Q..D .Y...G..YV ........Y. .E........ DeleDRB*0402 FR ..S..... ......Q..D .Y...G..YV ........Y. .E........ DeleDRB*0501 F...A..... .......FM. .Y...G..YV .C......Y. .......... Urma DRB*01 RMY.A..H.T .......FLA .S...R...A .F......Y. ........D. CeheBP18 DRB -------FS ........LV .D...R..LV ........H. ......Q.. ** MomoDRB*0101 ESLNSQKDFL ERRRAEVDTV CRHNYGVVE MomoDRB*0102 .......... .......... .......G. MomoDRB*0103 .......... .......... ......... MomoDRB*0104 .......... .......... ......... MomoDRB*0 105 .......... .......... ......... MomoDRB*0106 .......... .......... .......G. MomoDRB*0107 .......... ......... Y .......G. MomoDRB*0108 .......... .......... .K....... MomoDRB*0109 .......... .......... K ....... MomoDRB*0110 .......... ... ....... ......... MomoDRB*0111 .......... .......... .......G. Dele DRB *010 1 .......... .......... ... ...... Dele DRB*0102 .......... .......... .......G. Dele DRB *020 1 .......... ... ...... Y ... ...... Dele DRB*0202 .......... ... ...... Y ... ....G. Del eDRB*0301 KYW .....L. ... ...... Y ... ...... Dele DRB*0401 .YW.....L. .QN..AL.. Y ... ...... Dele DRB*0402 .YW.....L. .QN..AL.. Y ... ....G. Dele DRB*0501 ..F.....L. ..H..AL.. Y .......G. Urma DRB*01 ..W.P..EL. ..A..A... Y ....... G CeheBP18 DRB .KW...... .......... .......A.

PAGE 53

Figure 4. Example Chromatogram showing polymorphic site in heterozygous narwhal individual at DQB The site shows that at base pair 93 the individual shows both an A and

PAGE 54

ABSTRACT Conservation geneticists seek to examine genotype level diversity in species of concern in order to evaluate species risk level. There is evidence that humpback w hales as a species have increasing levels of diversity and are making good recovery from the bottleneck caused by whaling. However, the Arabian Sea subpopulation is at greater risk due to its isolation from other humpback subpopulations, limiting the intro duction of any new diversity. One region of the genome used in the analysis of genetic diversity is t he major histocompatibility complex (MHC) As a region of the genome coding for immunity against foreign pathogens, Class II of the MHC may not only give u s a snapshot of species health, but also help to deduce the evolution of a species under pathogenic pressures. In this paper, the Arabian Sea humpback whale subpopulation w as used as a model species to examine genetic diversity in the MHC, specifically at the locus DQB Polymorphism and sequence variation from genomic and allelic sequences was analyzed in 28 humpbacks In these individuals, 16 new alleles were found and six individuals displayed copy number variation. These findings may indicate that this s ubpopulation has undergone gene duplication as a genetic mechanism to artificially create increased diversity.

PAGE 55

T he humpback whale ( Megaptera novaengliae) is found throughout the oceans of the world (Figure 1) and makes exceedingly long dis tance seasonal migrations between feeding and breeding/calving grounds (Clapham & Link 2006). The different subpopulations or stocks, the latter term used for management purposes, have a northern versus southern hemisphere distribution with corresponding d ifferences in life history traits, e.g., timing of migration, breeding and calving timing (Baker & Medrano Gonzlez 2002). Like other baleen whales, humpback whales experienced extreme commercial th century and decreased by the

PAGE 58

Nige nda Mor ales et al. ( 2008 ) examin ed DQB in t he Gulf of California fin whale ( Balaenoptera physalus ) and found three alleles in 36 individuals and nine of the 13 amino acid changes were in the PBR and three of the se changes were in regions adjacent that would cau se physiochemical changes to the PBR. They found a greater non synonymous substitutions ( d N ) to synonymous substitutions ( d S ) per site [0.077 to 0.016] indicating positive selection. Nige nda Morales et al. assert that the peptide binding affinities of ea ch of the fin whale MHC proteins are variable adaptive differences due to the shift of physiochemical properties in the PBR or that the DQB alleles might have formed independently in different species [Minke and humpback whale] and converged from similar p athogen exposure. While some scientists postulate the marine environment provides species protection from pathogens as compared with terrestrial mammals (Trowsdale et al., 1989) (Slade, 1992), diseases and epizootics have been well documented in cetaceans ( Geraci et al., 1979; Smith et al., 1983; Van Bressem et al ., 1999 ; Van Bressem et al., 2009 ), arguing against reduced pathogen pressure acting on the MHC in marine mammals Here, I investigate the level of genetic diversity in a historically isolated and non migrating humpback whale population found all year in warmer low latitude waters. I hypothesize that the Oman population will have decreased MHC genetic variation at the DQB locus because of its low population size and isolation from other humpback wh ales populations, thereby limiting potential gene flow of new alleles into this population, which may increase their greater risk to new pathogens.

PAGE 59

Materials and Methods

PAGE 64

References Baker CS and Clapham PJ. Modelling the past and future of whales and whaling. T rends in Ecology and Evolution V ol.19 No.7 July 2004 of DQB and DRB like genes of the MHC in baleen whales (suborder: Mysticeti). Immunogenetics 2006. 58: 283 296. Brown, J.H., Jardetzhy, T.S., Gorga, J .C., Stern, L.J., Urban, R.G., Strominger, J.L., and Wiley, D.C. Three dimensional structure of the human class II histocompatibility antigen HLA DR1. Nature 364:33 39, 1993. Caron, D. (1995). The International Whaling Commission & The North Atlantic M arine Mammal Commission: The Institutional Risks of Coercion for Consensual Structures. American Journal of International Law 89 154 174. Clapham PJ & Link JS 2006. Whales, whaling, and ecosystems in the North Atlantic Ocean. In: Estes, JA, DeMaster DP, Doak DF, Williams TM, Brownell, Jr. RL, eds. Whales, Whaling, and Ocean Ecosystems. University of California Press, Berkeley. Pp.314323 Excoffier, L. and H.E. L. Lischer (2010) Arlequin suite ver 3.5: A new series of programs to perform population genet ics analyses under Linux and Windows. Molecular Ecology Resources. 10: 564 567. Geraci, J. R., Hicks, B. D., & St Aubin, D. J. (1979). Dolphin pox: a skin disease of cetaceans. Canadian Journal of Comparative Medicine 43(4), 399. Halvorsen O, Bye K. (19 99). Parasites, biodiversity, and population dynamics in an ecosystem in the high arctic. Veterinary Parasitology 84: 205 227. Harvell CD, Mitchell CE, Ward JR, Altizer S, Dobson AP, Ostfeld RS, Samuel MD. Climate warming and disease risks for terrestria l and marine biota. Science. 296: 2158 2162. Hedrick PW, Kim TJ. (2000). Genetics of complex polymorphisms: parasites and maintenance of the major histocompatibility complex variation. In: Evolutionary Genetics: Molecules to Morphology eds. Singh RS, Krim bas CK. Cambridge Univ. Press, New York.

PAGE 65

Hueffer K, O'Hara TM, Follmann EH. (2011). Adaptation of mammalian host pathogen interactions in a changing arctic environment. Acta Veterinaria Scandinavica 53: 17. IUCN. 2008. 2008 IUCN Red List of Threatened Species. Available at: http://www.iucnredlist.org. (Accessed: 5 October 2008). Arctic ungulates. Integrative and Comparative Biology 44: 109 118. Kutz SJ, Hoberg EP, Polley L, Jenkins EJ. (2005). Global warming is changing the dynamics of Arctic host parasite systems. Proceedings of the Royal Society: Biology 272: 2571 2576. Larkin M., et al. Clustal W and Clustal X version 2.0", Bioinformatics 2007 23(21):2947 2948 http://bioinformatics.oxfordjournals.org/cgi/content/full/23/21/2947 Librado, P. and Rozas, J. 2009. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451 1452 | doi: 10.1093/bioinformatics/btp187. Mikhalev YA Humpback whales Megaptera novaeangliae in the Arabian Sea. Marine Ecology Progress Series 1997; 149:13 21. Minton G, Collins TJQ, Pomilla C, Findlay KP, Rosenbaum HC, et al. (2008) Megaptera novaengliae (Borowski, 1781) (Arabian Sea subpopulations) Hum pback Whale. IUCN Redlist Population assessment for IUCN Redlist, 1 8. Murray BW, Michaud R, White BN. Allelic and haplotype variation of major histocompatibility complex class II DRB1 and DQB loci in the St. Lawrence beluga (Delphinapterus leucas). (199 9) Molecular Ecology 8;7: 1127 1139. Nicholas, K.B., Nicholas H.B. Jr., and Deerfield, D.W. II. 1997 GeneDoc : Analysis and Visualization of Genetic Variation, E mbnew .N ews 4:14 Nigenda Morales S, Flores Ramirez S, Uban R. J, Vazquez Juarez R. MHC DQB 1 Polymorphism in the Gulf of California Fin Whale (Balaenoptera physalus) Population. Journal of Heredity 2008: 99(1): 12 21. Oberthr, S. (1998). The International Convention for the Regulation of Whaling: from over exploitation to total prohibition. Year book of International Co operation on Environment an d Development 1999 Pomilla C, Collins T, Minton G, Findlay K, Matthew LS, Ponnampalam L, Baldwin R, Rosenbaum H. Genetic distinctiveness and decline of a small population of humpback whales (Megaptera novaengliae) in the Arabian Sea (Region X). 2010. SC/62/SH6.

PAGE 66

Reeves RR, Leatherwood S, Papastavrou V. Possible stock affinities of humpback whales in the Northern Indian Ocean. UNEP Marine Mammal Technical Reports. 1991; 3:259 269. Reeves, R. R., Swartz S. L., Wetmore, S. E., & Clapham, P. J. (2001). Historical occurrence and distribution of humpback whales in the eastern and southern Caribbean Sea, based on data from American whaling logbooks. Journal of Cetacean Research and Management 3 (2), 117 130. Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbn, J. & Zerbini, A.N. 2008. Megaptera novaeangliae In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012. 2. . Downloaded on 23 April 2013 Rosenbaum HC Pomilla C Mendez M Leslie MS Best PB Findlay KP Minton G Ersts PJ Collins T Engel MH Bonatto SL Kotze DP Meer M Barendse J Thornton M Razafindrakoto Y Ngouessono S Vely M Kiszka J Population structure of humpback whales from their breeding grounds in the South Atlantic and Indian Oceans. PLoS One. 2009 Oct 8;4(10):e7318 Sequencher version 5.1 sequence analysis software, Gene Codes Corporation, Ann Arbor, MI USA http://www.genecod es.com Slade R. Limited MHC polymorphism in the Southern Elephant Sea: Implications for MHC Evolution and Marine Mammal Population Biology. 1992 Proc R Soc B 249(1325) 163 171. Smith, A. W., Skilling, D. E., & Ridgway, S. (1983). Calicivirus induced ve sicular disease in cetaceans and probable interspecies transmission. Journal of the American Veterinary Medical Association 183(11), 1223. Smultea MA. Segregation by humpback whale (Megaptera novaeangliae) cows with a calf in coastal habitat near the isl and of Hawaii. Canadian Journal of Zoology 1994, 72(5): 805 811, 10.1139/z94 109 Trowsdale J, Groves V, Arnason A. Limited MHC polymorphism in whales. 1989. Immunogenetics 28:19 24. Van Bressem M, Van Warebeek K, Raga Esteve J. A review of virus infec tions of cetaceans and the potential impact of morbilliviruses, poxviruses and papillomaviruses on host population dynamics 1999 Diseases of Aquatic Organisms vol. 38, no. 1, p. 53 65. Van Bressem, M. F., Raga, J. A., Di Guardo, G., Jepson, P. D., Duign an, P. J., Siebert, U., & Van Waerebeek, K. (2009). Emerging infectious diseases in cetaceans worldwide and the possible role of environmental stressors Diseases of aquatic organisms 86(2), 143 157.

PAGE 67

Weber, D.S., Stewart, B.S., Schienman, J. & Lehman, N. (2004) Major histocompatibility complex variation at three class II loci in the northern elephant seal. Mol. Ecol. 13 711 718. Xia Xu S, Hua Ren W, Zhen Li S, Wen Wei F, Ya Zhou K, Yang G. Sequence Polymorphism and Evolution of three cetacean genes. 200 9. J Mol Evol 69:250 275. Yang, G., Yan, J., Zhou, K. & Wei, F. (2005) Sequence variation and gene duplication at MHC DQB loci of baiji (Lipotes vexillifer), a Chinese River dolphin. J Heredity 96, 310 317.

PAGE 68

Table 1 Humpback DQB Variability 1 Fu 1997 2 Tajima 1993 3 Kelly 1997 4 Chakraborty 1990 5 Ewens 1972; Watterson 1978

PAGE 69

Table 2. Humpback Published DQB Alleles

PAGE 70

Table 3. Humpback New DQB Alleles Meno DQB*24 N/A 5 45 TOTAL 6: OM01_012 4: OM02_009 13: OM02_011 10: OM02_019 12: OM02_026A Meno DQB*25 N/A 3 10 TOTAL 2: OM01_013 6: OM02_010 2: OM02_026A Meno DQB*26 N/A 2 3 TOTAL 1: OM01_008 2: OM01_016 Meno DQB *27 N/A 1 2 TOTAL 2: OM01_012 Meno DQB*28 N/A 1 2 TOTAL 2: OM02_019 Meno DQB*29 N/A 1 2 TOTAL 2: OM01_012 Meno DQB*30 N/A 1 2 TOTAL 2: OM02_019 Meno DQB*31 N/A 1 2 TOTAL 2: OM01_012 Meno DQB*32 N/A 1 2 TOTAL 2: OM01_00 4 Meno DQB*33 N/A 1 2 TOTAL 2: OM02_026A Meno DQB*34 N/A 1 2 TOTAL 2: OM02_010 Meno DQB*35 N/A 1 2 TOTAL 2: OM01_013 Meno DQB*36 N/A 3 OM01_007 OM01_009 OM01_010 Meno DQB*37 N/A 2 OM01_019 OM02_001 Meno DQB*38 N/A 2 OM01 _019 OM02_005 Meno DQB*39 N/A 3 OM01_020 OM02_001 OM02_006

PAGE 71

Table 4. Humpback Individuals and their respective Alleles Individual Hetero/Homo Clones Alleles OM01_003 hetero yes 5, 6 OM01_004 hetero yes 5, 32 OM01_008 hetero yes 5, 21, 26 OM01_012 hetero yes 5, 24, 27, 29, 31 OM01_013 hetero y es 6, 25, 35 OM01_016 hetero yes 5, 8, 26 OM01_018 hetero yes 5, 6 OM02_002 hetero yes 5, 8 OM02_009 hetero yes 21, 24 OM02_010 hetero yes 5, 25, 34 OM02_011 hetero yes 6, 24 OM01_006 hetero no N1, N2 OM01_007 hetero no N3, 36 OM01_00 9 hetero no N5, 36 OM01_010 hetero no N7, 36 OM01_011 hetero no N8, N9 OM01_017 hetero no N10, N11 OM01_019 hetero no N13, 37, 38 OM01_020 hetero no N14, 39 OM02_001 hetero no 37, 39 OM02_003 hetero no N16, N17 OM02_004 HOMO no N3 OM02_005 hetero no N18, 38 OM02_006 hetero no N17, 39 OM02_008 hetero no N19, N20 OM02_019 hetero clone only 24, 28, 30 OM02_026A hetero clone only 24, 25, 33

PAGE 72

Figure 1. Global Humpback Populat ions. World map of the global humpback distribution showing breeding areas in yellow a nd feeding areas in green. Note the Oman humpback population which is shown in red and is distinct in that it breeds and feeds i n the same area, indicating a lack of migration. Accessed from: http://www.nature.nps.gov/biology/migratoryspecies/humpbackwhale.cfm on May 1 7 2013

PAGE 73

Figure 2. Breeding Stock X Map of breeding stock X. This map shows a close up of the Gulf of Oman, shown in white, with Iran to the North and Oman bordering to the Southwest. (Taken from Pomilla et al., 2010)

PAGE 74

Figure 3 Amino acid variation in class II of the MHC in DQB genotypes of the humpback. This alignment compares the amino acids found in all known humpback DQB alleles (Baker et al., 2006 for DQB Meno DQB *1 through DQB *23) with the bowhead whale ( Balaena mysticetus ) (Baker et al., 2006), fin whale ( Baleonoptera phyalis ) (Baker et al., 2006), grey whale ( Erchrichtius robustus ) (Baker et al., 2006), southern right whale ( Eubalaena australis ) (Baker et al., 2006) and belug a ( Delphinapterus leucas ) (Murray et al., 1999). ( Dots (.) mark identity with top sequence. Dashes ( ) indicate lack of data. Asterisks (*) indicate the peptide binding region as determined by Brown et al., 1993. (a) DQB * MenoCA DQB*1 TERVRLVVRH IYNREEFARF DSDVGEYRAV TELGRPSAKY WNSQKDLLEQ TRAELDT MenoCA DQB*2 .......E.D .......L.. .......... ......I.EN .......... R..AV.. MenoCA DQB*3 .......T.Y .......... .......... S.....D.E. ......I..E ...AV.. MenoCA DQB*4 .....A.E.Y ......Y... .......... S.....D.E. .......... ...AV.. MenoCA DQB*5 .......T.Y ......Y... .......... S.....D.E. ......I... ....... MenoCA DQB*6 .....A.E.Y .... ...... .......... S.....D.E. .......... ...AV.. MenoCA DQB*7 .....A.E.Y ......Y... .......... S.....D.E. ......I..E ...AV.. MenoCA DQB*8 .......T.Y .......... .......... S.....D.E. .......... ....... MenoCA DQB*9 .......T.Y ......Y... .......... S... ..D.E. ......I..E ...AV.. MenoCA DQB*10 .......T.Y .......... .......... ......D.E. .......... ....... MenoGB DQB*11 .......... ......Y... .......... S.....D.E. ......I... ....... MenoGB DQB*12 .......T.Y .......... .......... .......... .......... .... ... MenoCA DQB*13 .......... ......Y... .......... ........E. .......... R...V.. MenoGB DQB*14 .......E.D ......Y... .......... S.....D.E. ......I... ....... MenoGM DQB*15 .......E.D .......L.. .......... ......I.EN .......... R...V.. MenoGM DQB*16 ... ...LE.Y .......... .......... S.....D.E. .......... R..AV.. MenoGM DQB*17 ......LE.Y .......... .......... S.....D.E. .......... R...V.. MenoSE DQB*18 .....A.E.Y ......Y... .......... S.....D.E. ......I... ....... MenoSE DQB*19 .......... ......Y... ... ....... S.....D.E. ......I..E ...AV.. MenoSE DQB*20 .......... ......Y... .......... ........E. ......I..E ...AV.. MenoSE DQB*21 .....A.E.Y .......... .......... S.....D.E. .......... ...AV.. MenoSE DQB*22 .......... ......Y... .......... .......... ... ....... R...V.. MenoSE DQB*23 .......T.Y .......... .......... S.....D.E. ......I..E ....... MenoDQB*24 .......T. Y ......Y... ...... ... S.....D.E. ......I... ....... MenoDQB*25 .......T. Y ......Y... ...... ... ........E. ......I... ....... MenoDQB* 26 .....A.E. Y ......F... H ......... S.....D.Q. .......... ...AV.. MenoDQB*27 .......T. Y ...... Y ... ...... ... S......... .......... ...AV.. MenoDQB*28 .....A. EGY ...... Y ... ...... ... S......... .......... ...AV.. MenoDQB*29 .....A.E. Y ...... Y .. ...... ...A S......... .......... ...AV.. MenoDQB*30 .....A. EKY ...... Y ... ...... ... S......... .......... ...AV.. MenoDQB*31 .....A.E. Y ...... Y ... ...... ... S......... .........R ...AV.. MenoDQB*32 .......T. Y ...... F ... ... M ...... S.....D.E. .......... ....... MenoDQB*33 .......T. Y ...... Y ... ...... ... ......S.E. ......I... ...KL.. MenoDQB*34 .......T. Y ...... Y ... ...... ... ........E. ......V... ....... MenoDQB*35 .....A.E. Y ...... F ... ...... ... S.....D.E. .......... ...AV.. MenoDQ B*36 .....A.E. Y ...... F ... ...... ... S.....D... .......... ...AV.. MenoDQB*37 .....P.D. Y ...... ? P .. ...... ... S.....D.EN .......... ....V.. MenoDQB*38 .......E. D ...... FL.. ...... ... ......I.E. L ......... R...V.. MenoDQB* 3 9 .......E. Y ...... FV.. ...... ... ......F.E. ......I... R...V.. BamyDQB*1 .....A.T.Y ......Y... .......... S.......E. ......I... E..AV.. BamyDQB*2 .......SSY ......Y... .......... S.....D.E. ......I... ....... BamyDQB*3 .....Y.SSY ......Y... .......... S.....D .E. ......I... ....... BaphMDQB*1 .....Y.T.Y .......... ......F... S.....D... .......... R...V.. BaphMDQB*2 .......E.Y .......... .......... S.....V.EK .......... R...V.. EsroWaDQB*1 .......E.Y ......Y... .......... ......D... .........K R...... EsroWaDQB*2 .....Y.S.Y ......Y... .......... ......D... ......I... ....... Euau DQB*1c .....Y.T.. ......YV.. .......... .......... ......H... R...... Euau DQB*2c .....Y.T.. ......YV.. .......... S.....D.E. ......I... ....... Euau DQB*3c ...... .T.Y ......LV.. .......... S.....D.E. ......I..R E..AV.. Euau DQB*4c .......SSY ......Y... .......... S.....D.E. ......I..R E..AV.. Euau DQB*5c .......T.Y ......LV.. .......... S.....D.E. ......I... ....... Dele DQB*0101 .......S.Y ......LVH. ...... .... ......D.E. ......I..R .......

PAGE 75

Figure 4 (a). Chromatogram for Individual OM01_012 showing polymorphic site at base Figure 4 (b). Chrom atogram for Individual OM01_012 showing 14 clones.

PAGE 76

Figure 5 Chromatogram from Individual OM01_012 showing two clones. Base pair 10 is This is complementary to the data from the direct

PAGE 80

Laidre, K. L., Stirling, I., Lowr y, L.F., Wiig, Heide Jrgensen, M. P. and Ferguson, S.H. 2008. Quantifying the sensitivity of Arctic marine mammals to climate induced habitat change. Ecological Applications 18 (Supplement: Arctic Marine Mammals): 97 125.

PAGE 82

Appendix 1

PAGE 85

It also has been hypothesized that the MHC could be hitchhiking with transfer RNA or histo ne clusters or vice versa (Malf r o y et al., 1997). Genetic hitchhiking is the p rocess by which an allele may increase in frequency because it is linked to a gene that is being positively selected.

PAGE 86

References :

PAGE 87

A ppendix 1,

PAGE 90

Appendix 2 Narwhal DQB New Allele Sequences DQB* 0202 CACGGAGCGGGTGCGGCTCGTGA GCAGATACATCTATAACCGGGAGG AGTTAGTGCACTTCGACAGCGACGTGGGCGAGTACCGGGCGGTGACC GAGCTGGGCCGGCGGA CGCCGAGTACTGGAACAGCCAGAAGGACATCCTGGAGCGGACACGGG CCGAGCTGGACACG DQB* 0203 CACGGAGCGGGTGCGGGGTGTGAGCAGATACATCTATAACCGGGAGG AGTACGTGCGCTTCGACAGCGACGTGGGCGAGTACCGGGCGGTGACC GA GCTGGGCCGGCGGACCGCCGAGTACTGGAACAGCCAGAAGGACAT CCTGGAGCGGACACGGGCCGAGCTGGACACG DQB* 0204 CACGGAGCGGGTGCGGCTCGTGAGCAGATACATCTATAACCGGGAGG AGTACGTGCGCTTCGACAGCGACGTGGGCGAGCACCGGGCGGTGACC GAGCTGGGCCGGCGGACCGCCGAGTACTGGAACAGCCAGAAGGACAT CCTGGAGCGGACACGGGCCGAGCTGGAC ACG DQB* 0205 CACGGAGCGGGTGCGGCTCGTGAGCAGATACATCTATAACCGGGAGG AGTACGTGCGCTTCGACAGCGACGTGGGCGAGTACCGGGCGGTGACC GAGCTGGGGCGGCCGACCGCCGAGTACTGGAACCGCCAGAAGGACAT CCTGGAGCGGACACGGGCCGAGCTGGACACG DQB* 0206 GACAGAGCGGGTGCGGCTCGTGAGCAGACACATCTATAACCGGGAGG AGTACGTGCGCT TCGACAGCGACGTGGGCGAGTACCGGGCGGTGACC GAGCTGGGCCGGCCGACCGCCGAGTACTGGAACAGCCAGAAGGACAT CCTGGAGCGGACACGGGCCGAGCTGGACACG DQB* 0207 CACGGAGCGGGTGCGGGGTGTGAGCAGATACATCTATAACCGGGAGG AGTACGTGCGCTTCGACAGCGACGTGGGCGAGCACCGGGCGGTGACC GAGCTGGGGCGGCGCATCGCTGAGTACTGCAACAGCCA GAAGGACAT CCTGGAGCGGACACGGGCCGAGGTGGACACG DQB* 0208 GACGGAGCGGGTGCGGCTCGTGAGCAGACACATCTATAACCGGGAGG AGTACGTGCGCTTCGACAACGACGTGGGCGAGTACCGGGCGGTGACC GAGCTGGGCCGGCGGGCCGCCGAGTACTGCAACAAGCAGAAGGACAT CATGGAGCGGACACGGGCCGAGCTGGACACG

PAGE 91

Appendix 3 Narwhal DRB New A lleles Allele Name Sequence DRB*0104 TCCCAGTTTAAGAGCGAGTGTCGTTTCTCTAATGGGACAGAGCGGGTGCGGCTCGTGACC AGACACATCTATAACGAGGAGGAATTCATGCGCTACGACAGCGACGTGGGCGAGTGCCGG GCGGTGACCGAGCTGGGCCGGCGGACCGCCGAGTCCTTGAACAGCCAGAAGGACTTCCTG GAGCGGAGACGGGCCGAGGTGGACACGGTGTGCAGACA CAACTACGGGGTTGTGGAGA DRB*0105 TCCCGGTTTAAGAGCGAGTGTCGTTTCTCTAATGGGACAGAGCGGGTGCGGCTCGTGACC AGACACATCTATAACGAGGAGGAATTCATGCGCTACGACAGCGACGTGGGCGAGTGCCGG GCGGTGACCGAGCTGGGCCGGCGGACCGCCGAGTCCTTGAACAGCCAGAAGGACTTCCTG GAGCGGAGACGGGCCGAGGTGGACACGGTGTGCAGACACAACTAC GGGGTTGTGGAGA DRB*0106 TCCCAGTTTAAGAGCGAGTGTCGTTTCTCTAATGGGACAGAGCGGGTGCGGCTCGTGACC AGACACATCTATAACGAGGAGGAATTCATGCGCTACGACAGCGACGTGGGCGAGTGCCGG GCGGTGACCGAGCTGGGCCGGCGGACCGCCGAGTCCTTGAACAGCCAGAAGGACTTCCTG GAGCGGAGACGGGCCGAGGTGGACACGGTGTGCAGACACAACTACGGGGTTG GGGAGA DRB*0107 TCCCGGTTTAAGAGCGAGTGTCGTTTCTCTAATGGGACAGAGCGGGTGCGGCTCGTGACC AGACACATCTATAACGAGGAGGAATTCATGCGCTACGACAGCGACGTGGGCGAGTGCCGG GCGGTGACCGAGCTGGGCCGGCGGACCGCCGAGTCCTTGAACAGCCAGAAGGACTTCCTG GAGCGGAGACGGGCCGAGGTGGACACGTACTGCAGACACAACTACGGGGTTGGGGAGA DRB*0108 TCCCAGTTTAAGAGCGAGTGTCGTTTCTCTAATGGGACAGAGCGGGTGCGGCTCGTGACC AGACACATCTATAACGAGGAGGAATTCATGCGCTACGACAGCGACGTGGGCGAGTGCCGG GCGGTGACCGAGCTGGGCCGGCGGACCGCCGAGTCCTTGAACAGCCAGAAGGACTTCCTG GAGCGGAGACGGGCCGAGGTGGACACGGTGTGCAAACACAACTACGGGGTTGTGGAGA DRB*01 09 TCCCGGTTTAAGAGCGAGTGTCGTTTCTCTAATGGGACAGAGCGGGTGCGGCTCGTGACC AGACACATCTATAACGAGGAGGAATTCATGCGCTACGACAGCGACGTGGGCGAGTGCCGG GCGGTGACCGAGCTGGGCCGGCGGACCGCCGAGTCCTTGAACAGCCAGAAGGACTTCCTG GAGCGGAGACGGGCCGAGGTGGACACGGTGTGCAAACACAACTACGGGGTTGTGGAGA DRB*0110 TCCC GGTTTAAGAGCGAGTGTCATTTCTCTAATGGGACAGAGCGGGTGCGGGTCGTGACC AGACACATCTATAACGAGGAGGAATTCATGCGCTACGACAGCGACGTGGGCGAGTGCCGG GCGGTGACCGAGCTGGGCCGGCGGACCGCCGAGTCCTTGAACAGCCAGAAGGACTTCCTG GAGCGGAGACGGGCCGAGGTGGACACGGTGTGCAGACACAACTACGGGGTTGTGGAGA DRB*0111 TCCCGGTTTAA GAGCGAGTGTCGTTTCTCTAATGGGACAGAGCGGGTGCGGCTCGTGACC AGACACATCTATAACGAGGAGGAATTCATGCGCTACGACAGCGACGTGGGCGAGTGCCGG GCGGTGACCGAGCTGGGCCGGCGGACCGCCGAGTCCTTGAACAGCCAGAAGGACTTCCTG GAGCGGAGACGGGCCGAGGTGGACACGGTGTGCAGACACAACTACGGGGTTGGGGAGA

PAGE 92

Appendix 4. Humpback DQB Alleles DQB*24 CACGGAGCGGGTGCGGGCAGTGGAGAGATACATCTATAACCGGGAGGAGTACGCGCGCTTC GACAGCGACGTGGGCGAGTACCGGGCGGTGAGCGAGCTGGGCCGGCCGTCCGCCAAGTACT GGAACAGCCAGAAGGACCT CCTGGAGCAGACA CGGGCCGCGGTGGACACG DQB*25 CACGGAGCGCGTGCGGCTCGTGACCAGATACATCTATAACCGTGAGGAGTACGCGCGCTTC GACAGCGACGTGGGCGAGTACCGGGCGGTGACCGAGCTGGGCCGGCCGTCCGCCGAGTACT GGAACAGCCAGAAGGACATCCTGGAGCAGACACGGGCCGAGCTGGACACG DQB*26 CACGGAGCGGGTGCGGGCAGTGGAGAGATACATCTATAACCGGGAGGAGTTCGCGCGCTTC CACAGCGACGTGG GCGAATACCGGGCGGTGAGCGAGCTGGGCCGGCCGGACGCCCAGTACT GGAACAGCCAAAAGGACCTCCTGGAGCAGACACGGGCCGCGGTGGACACG DQB*27 CACGGAGCGCGTGCGGCTCGTGACCAGATACATCTATAACCGGGAGGAGTACGCGCGCTTC GACAGCGACGTGGGCGAGTACCGGGCGGTGAGCGAGCTGGGCCGGCCGTCCGCCAAGTACT GGAACAGCCAGAAGGACCTCCTGGAG CAGACACGGGCCGCGGTGGACACG DQB*28 CACGGAGCGGGTGCGGGCAGTGGAGGGATACATCTATAACCGGGAGGAGTACGCGCGCTTC GACAGCGACGTGGGCGAGTACCGGGCGGTGAGCGAGCTGGGCCGGCCGTCCGCCAAGTACT GGAACAGCCAGAAGGACCTCCTGGAGCAGACACGGGCCGCGGTGGACACG DQB*29 CACGGAGCGGGTGCGGGCAGTGGAGAGATACATCTATAAC CGGGAGGAGTACGCGCGCTTC GACAGCGACGTGGGCGAGTACCGGGCGGCGAGCGAGCTGGGCCGGCCGTCCGCCAAGTACT GGAACAGCCAAAAGGACCTCCTGGAGCAGACACGGGCCGCGGTGGACACG DQB*30 CACGGAGCGGGTGCGGGCAGTGGAGAAATACATCTATAACCGGGAGGAGTACGCGCGCTTC GACAGCGACGTGGGCGAGTACCGGGCGGTGAGCGAGCTGGGCCGGCCGTCCGC CAAGTACT GGAACAGCCAGAAGGACCTCCTGGAGCAGACACGGGCCGCGGTGGACACG DQB*31 CACGGAGCGGGTGCGGGCAGTGGAGAGATACATCTATAACCGGGAGGAGTACGCGCGCTTC GACAGCGACGTGGGCGAGTACCGGGCGGTGAGCGAGCTGGGCCGGCCGTCCGCCAAGTACT GGAACAGCCAGAAGGACCTCCTGGAGCGGACACGGGCCGCGGTGGACACG DQB*32 CGTGTC CAGCTCGGCCCGTGTCTGCTCCAGGAGGTCCTTCTGGCTGTTCCAGTACTCGGCG TCCGGCCGGCCCAGCTCGCTCACCGCCCGGTACTCGCCCATGTCGCTGTCGAAGCGCGCGA ACTCCTCACGGTTATAGATGTACCTGGTCACGAGCCGCACGCGCTCCGTG DQB*33 CACGGAGCGCGTGCGGCTCGTGACCAGATACATCTATAACCGTGAGGAGTACGCGCGCTTC GACAGCGACGTGGGCGAGT ACCGGGCGGTGACCGAGCTGGGCCGGCCGTCCGCCGAGTACT GGAACAGCCAGAAGGACATCCTGGAGCAGACACGGGCCAAGCTGGACACG DQB*34 CACGGAGCGCGTGCGGCTCGTGACCAGATACATCTATAACCGTGAGGAGTACGCGCGCTTC GACAGCGACGTGGGCGAGTACCGGGCGGTGACCGAGCTGGGCCGGCCGTCCGCCGAGTACT GGAACAGCCAGAAGGACGTCCTGGAGCAGACA CGGGCCGAGCTGGACACG DQB*35 CACGGAGCGGGTGCGGGCAGTGGAGAGATACATCTATAACCGGGAGGAGTTCGCGCGCTTC GACAGCGACGTGGGCGAATACCGGGCGGTGAGCGAGCTGGGCCGGCCGGACGCCGAGTACT GGAACAGCCAGAAGGACCTCCTGGAGCAGACACGGGCCGCGGTGGACACG DQB*36 CGTGTCCACCGCGGCCCGTGTCTGCTCCAGGAGGTCCTTCTGGCTG TTCCAGTACTTGGCG TCCGGCCGGCCCAGCTCGCTCACCGCCCTGTACTCGCCCACGTCGCTGTCGAAGCGCGCGA ACTCCTCCCGGTTATAGATGTATCTCTCCACTGCCCGCACCCGCTCCGTG DQB*37 CGTGTCCACCTCGGCCCGTG TCTGCTCCAGGAGGTCCTTCTGGCTGTTCCAGTTCTCGGCG TCCGGCCGGCCCAGCTCGCTCACCGCCCTGTACTCGCCCACGTCGCTGTCGAAGCGCGGTT ACTCCTCCCGGTTATAGATGTATCTGTCCACTGGCCGCACCCGCTCCGTG DQB*38 CGTGTCCACCTCGGCCCGTCTCTGCTCCAGGAGGTCCTTCTGGCTGTTCAAGTACTCGGCG ATCGGCCGGCCCAGCTCGGTCACCGCCC GGTACTCGCCCACGTCGCTGTCGAAGCGCAGGA ACTCCTCCCGGTTATAGATGTCTCTCTCCACTAGCCGCACGCGCTCCGTG DQB*39 CGTGTCCACCTCGGCCCGTCTCTGCTCCAGGATGTCCTTCTGGCTGTTCCAGTACTCGGCG AACGGCCGGCCCAGCTCGGTCACCGCCCGGTACTCGCCCACGTCGCTGTCGAAGCGCACGA ACTCCTCACGGTTATAGATGTATCTCTCCACTAGCC GCACGCGCTCCGTG


ERROR LOADING HTML FROM SOURCE (http://ncf.sobek.ufl.edu//design/skins/UFDC/html/footer_item.html)