ERROR LOADING HTML FROM SOURCE (http://ncf.sobek.ufl.edu//design/skins/UFDC/html/header_item.html)

Using Oligonucleotide Probes for in Situ Hybridization in Developing Cml322 Maize Endosperm

Permanent Link: http://ncf.sobek.ufl.edu/NCFE004674/00001

Material Information

Title: Using Oligonucleotide Probes for in Situ Hybridization in Developing Cml322 Maize Endosperm
Physical Description: Book
Language: English
Creator: Sonchaiwanich, Alyssa
Publisher: New College of Florida
Place of Publication: Sarasota, Fla.
Creation Date: 2012
Publication Date: 2012

Subjects

Subjects / Keywords: Maize
Endosperm
In Situ Hybridization
Genre: bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: This thesis research was a part of a larger research effort funded by the National Science Foundation to study the regulation of early endosperm development in Zea mays L. As part of the larger study, a group of inbred lines generated around the world are being studied to look for variations in development as compared to the standard reference line, B73. A second major goal of the grant is to identify key regulator genes and their patterns of localization. Preliminary visualization of sections of the line CML322 seemed to indicate precocious kernel (including of the endosperm) development. Digital imaging and morphometry were undertaken for this thesis to systematically test this hypothesis. We confirmed that the CML322 endosperm does grow precociously under greenhouse conditions in Florida. The CML322 line was then used to test the efficacy of a new generation of hyper-labeled oligonucleotide probes for in situ hybridization. Specifically, a probe complementary to the transcript encoding the 27 kilodalton (kDa) gamma zein storage protein was employed as a test case for determining the conditions needed to assess the expression patterns of genes currently being identified by the larger project. Results showed that these probes are useful for probing transcripts located in maize tissue and may be used in the future to assess the expression of target genes such as marker genes and transcription factors within maize tissue. Unfortunately, this particular type of oligonucleotide probe has now become unavailable; however, if/when it does become available again (as the vendor says it will), the optimal conditions for this tissue have been determined and can be modified as needed for each probe. Even if other types of probes, such as complimentary RNA probes, need to be used, some of the conditions identified here will be useful.
Statement of Responsibility: by Alyssa Sonchaiwanich
Thesis: Thesis (B.A.) -- New College of Florida, 2012
Electronic Access: RESTRICTED TO NCF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE
Bibliography: Includes bibliographical references.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The New College of Florida, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Local: Faculty Sponsor: Clore, Amy (faculty Sponsor)

Record Information

Source Institution: New College of Florida
Holding Location: New College of Florida
Rights Management: Applicable rights reserved.
Classification: local - S.T. 2012 S69
System ID: NCFE004674:00001

Permanent Link: http://ncf.sobek.ufl.edu/NCFE004674/00001

Material Information

Title: Using Oligonucleotide Probes for in Situ Hybridization in Developing Cml322 Maize Endosperm
Physical Description: Book
Language: English
Creator: Sonchaiwanich, Alyssa
Publisher: New College of Florida
Place of Publication: Sarasota, Fla.
Creation Date: 2012
Publication Date: 2012

Subjects

Subjects / Keywords: Maize
Endosperm
In Situ Hybridization
Genre: bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: This thesis research was a part of a larger research effort funded by the National Science Foundation to study the regulation of early endosperm development in Zea mays L. As part of the larger study, a group of inbred lines generated around the world are being studied to look for variations in development as compared to the standard reference line, B73. A second major goal of the grant is to identify key regulator genes and their patterns of localization. Preliminary visualization of sections of the line CML322 seemed to indicate precocious kernel (including of the endosperm) development. Digital imaging and morphometry were undertaken for this thesis to systematically test this hypothesis. We confirmed that the CML322 endosperm does grow precociously under greenhouse conditions in Florida. The CML322 line was then used to test the efficacy of a new generation of hyper-labeled oligonucleotide probes for in situ hybridization. Specifically, a probe complementary to the transcript encoding the 27 kilodalton (kDa) gamma zein storage protein was employed as a test case for determining the conditions needed to assess the expression patterns of genes currently being identified by the larger project. Results showed that these probes are useful for probing transcripts located in maize tissue and may be used in the future to assess the expression of target genes such as marker genes and transcription factors within maize tissue. Unfortunately, this particular type of oligonucleotide probe has now become unavailable; however, if/when it does become available again (as the vendor says it will), the optimal conditions for this tissue have been determined and can be modified as needed for each probe. Even if other types of probes, such as complimentary RNA probes, need to be used, some of the conditions identified here will be useful.
Statement of Responsibility: by Alyssa Sonchaiwanich
Thesis: Thesis (B.A.) -- New College of Florida, 2012
Electronic Access: RESTRICTED TO NCF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE
Bibliography: Includes bibliographical references.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The New College of Florida, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Local: Faculty Sponsor: Clore, Amy (faculty Sponsor)

Record Information

Source Institution: New College of Florida
Holding Location: New College of Florida
Rights Management: Applicable rights reserved.
Classification: local - S.T. 2012 S69
System ID: NCFE004674:00001


This item is only available as the following downloads:


Full Text

PAGE 1

USING OLIGONUCLEOTIDE PROBES FOR IN SITU HYBRIDIZATION IN DEVELOPING CML322 MAIZE ENDOSPERM BY: ALYSSA SONCHAIWANICH A THESIS Submitted to the Division of Natural Sciences New College of Florida in partial fulfillment of the requirements for the degree Bachelor of Arts Under the sponsorship of Dr. Amy Clore Sarasota, Florida May, 2012

PAGE 2

ii ACKNOWLEDGEMENTS I would like to thank my M om and sister for their uncon ditional support during my four years here, especially during the thesis writing process. I would not be where I am today without them, and for that, I am eternally grateful. A special thanks to my D ad, whose support and faith since the beginning has mad e me the person I am today. I am incredibly grateful to have Dr. Amy Clore as my thesis sponsor as well as a mentor to me. Her guidance and knowledge have taught me many things throughout the years and for that, I am thankful. I would also like to thank the lab as a whole, especially Mr. Joel Thurmond, for his assistance in collecting data and taking pictures of B73. I am also appreciative of Dr. Elzie McCord and Dr. Alfred Beulig, my committee members who have been extremely supportive and helpful with my thesis. Lastly, I want to thank all my friends who have supported me all four years, and especially this past year. A sp ecial thanks to Lynn Gusman, Monica Tambay and Phil Carrasco for being there for me, no matter what.

PAGE 3

iii TABLE OF CONTENTS Table of Contents ................................ ................................ ................................ .............. ii Figures ................................ ................................ ................................ ................................ .. v Abstract ................................ ................................ ................................ .............................. v i Chapter 1: Introduction ................................ ................................ ................................ .... 1 1.1 Endosperm and Its Importance ................................ ................................ ................... 1 1.1.1 What is Endosperm? ................................ ................................ ............................ 1 1.2 Endosperm Development ................................ ................................ ........................... 3 1.2.1 Endosperm Coenocyte Formation ................................ ................................ ....... 3 1.2.2 Endosperm Cellularization ................................ ................................ .................. 4 1.2.3 Endosperm Differentiation ................................ ................................ .................. 5 1.3 Description of NSF Funded Project on Early Endosperm Development in Maize ... 8 1.4 Techniques of In Situ Hybridization (ISH) ................................ .............................. 11 1.4.1 General Overview of ISH ................................ ................................ .................. 11 1.4.2 Gamma Zein Used as a Test Case ................................ ................................ ..... 1 3 Chapter 2: Materials and Methods ................................ ................................ ................ 1 7 2.1 Overview of Plant Materials ................................ ................................ .................... 17 2.2 Overview of Morphometry Technique ................................ ................................ ..... 17 2.2.1 Tissue Fixation, Vibratome Sectioning, and Staining ................................ ....... 17 2.2.2 Morphometry Technique (ImageJ) ................................ ................................ .... 18 2.3 In Situ Hyb ridization Methods ................................ ................................ ................. 20 2.3.1 Paraffin Embedment ................................ ................................ .......................... 20 2.3.1.1 Ethanol:Acetic Acid Fi xation ................................ ................................ .... 20 2.3.1.2 Dehydration Series ................................ ................................ ..................... 20 2.3.1.3 Infiltration ................................ ................................ ................................ .. 21 2.3.1.4 Embedment ................................ ................................ ................................ 21 2.3.2 Microtome Sectioning ................................ ................................ ....................... 22 2.3.3 Hematoxylin Staining ................................ ................................ ........................ 23 2.3.4 Probe Information ................................ ................................ .............................. 24

PAGE 4

iv 2.3.5 In Situ Hybridization ................................ ................................ ......................... 24 2.3.6 Control: In Situ Hybridization with RNase Solution ................................ ........ 28 Chapter 3: Results ................................ ................................ ................................ ............ 29 3.1 Morphometry Results ................................ ................................ ............................... 29 3.2 In Situ Hybridization Results ................................ ................................ ................... 36 3.2.1 Hematoxylin Staining Results ................................ ................................ ........... 36 3.2.2 In Situ Hybridization Troubleshooting Results ................................ ................. 36 Chapter 4: Discussion and Future Directions ................................ ............................... 40 4.1 Discussion of Morphometry Results ................................ ................................ ........ 40 4.2 Discussion of In Situ Hybridization Results ................................ ............................ 41 4.3 Future Experiments ................................ ................................ ................................ .. 42 4.3.1 Determining the Environmental Factors Responsible for the Rapid Endosperm Development in CML 322 ................................ ................................ ......................... 42 4.3.2 Location of Target Genes, Transcription Fac tors, and Marker Genes .............. 43 4.3.3 ISH Comparison of B73 and CML 322 ................................ ............................. 44 4.3.4 Limitation of Formula for Endosperm Volume ................................ ................. 44 4. 4 Overall Summary ................................ ................................ ................................ ..... 45 References ................................ ................................ ................................ ......................... 46

PAGE 5

v FIGURES Figure 1. Diagram of the megagametophyte ................................ ................................ ........ 2 Figure 2. Divisio of the central cell without cellularization ................................ ................ 3 Figure 3. Endosperm coenocyte after three rounds of mitosis ................................ ............. 4 Figure 4. Complete endosperm coenocyte ................................ ................................ ........... 4 Figure 5. Formation of RMS in endosperm coenocyte ................................ ........................ 4 Figure 6. Formation of alveoli in endosperm coenocyte ................................ ..................... 5 Figure 7. Complete cellularization of maize endosperm after 4 DAP ................................ 5 Figure 8. Four different cell types of maize endosperm ................................ ...................... 6 Figure 9. Development of protein body ................................ ................................ ............. 15 Figure 10. Cartoon depictions of longitudinal section of maize kernels and their cytological measurements ................................ ................................ ................................ .. 19 Figure 11. Cartoon depictions of cross section of maize kernels and their cytological measurements ................................ ................................ ................................ ..................... 19 Figure 12. Diagram of trapezoid trimming of the face of the paraffin block .................... 23 Figure 13. Depiction of hybridization and color reactions ................................ ................ 27 Figure 14. B73 and CML322 kernels at 1, 3, 4, and 5 DAP ................................ .............. 30 Figure 15. B73 and CML322 kernels at 7, 9, and 12 DAP ................................ ................ 31 Figure 16. Proportions of total kernel volume occupied by different tissues in B73 from 0 12 DAP ................................ ................................ ................................ .......................... 33 Figure 17. Proportions of total kernel volume occupied by different tissues in CML322 from 0 12 DAP ................................ ................................ ................................ .................. 33 Figure 18. E ndosperm volume for B73 and CML322 at each DAP ................................ .. 35 Figure 19. Hematoxylin stained 12 DAP CML322 tissue ................................ ................. 36 Figure 20. Comparison of tissue in the embryo and immediate surrounding region ......... 37 Figure 2 1. ISH experiments on 12 DAP CML322 tissue using antisense, sense, and poly T probes ................................ ................................ ................................ ........................... 39

PAGE 6

vi USING OLIGONUCLEOTIDE PROBES FOR IN SITU HYBRIDI ZATION IN DEVELOPING CML322 MAIZ E ENDOSPERM Alyssa Sonchaiwanich New College of Florida, 2012 ABSTRACT This thesis research was a part of a large r research effort funded by the National Science Foundation to study the regulation of early endosperm development in Zea mays L As part of the larger study, a group of inbred lines generated around the world are bein g studied to look for variations in development as compared to the standard reference line, B73. A second major goal of the grant is to identify key regulator genes and their patterns of localization. Preliminary visualization of sections of the line CML 322 seemed to indicate precocious kernel (including of the endosperm) development Digital imaging and morphometry w ere under taken for this thesis to systema tically test this hypothesis. We confirmed that the CML322 endosperm does grow precociously under greenhouse conditions in Florida. The CML322 line was then used to test the efficacy of a new gene ration of hyper labeled oligonucleotide probe s for in situ hybridization. Specifically, a probe complementary to the transcript encoding the 27 kilodalton (kDa) gamma zein storage protein was employed as a test case for determining the conditions needed to assess the expression patterns of genes currently being identified by the larger project. Results showed that these probes are useful for probing transcr ipts located in maize tissue and may be used in the future to assess the expression of target genes such as marker genes

PAGE 7

vii and transcription factors within maize tissue. Unfortunately, this particular type of oligonucleotide probe has now become unavailable ; however, if/when it does become available again (as the vendor says it will) the optimal conditions for this tissue have been determined and can be modified as needed for each probe. Even if other types of probes, such as complimentary RNA probes, need to be used, some of the conditions identified here will be useful. _________________________ Dr. Amy Clore Division of Natural Sciences

PAGE 8

1 CHAPTER 1: INTRODUCTION 1.1 Endosperm and Its Importance 1.1.1 What is endosperm? The endosperm is a tissue found inside seeds of flowering plants that pl ays a significant role in plant as well as human and animal nutrition The endosperm is also known as a source of renewa ble and biodegradable materials. W ith this knowledg e, there have been many attempts to improve its use in feed (for livestock) and food products as well as its refinement to secondary products (i.e. oils and bioplastics) (Lopes and Larkins, 1993) It has long been hy pothesized that the endosperm and its development originated from earlier examples of double fertilization in angiosperms. In 1900, Sargant hypothesized that in the original angiosperms, double fertilization created a second embryo, which later developed into a functional storage body, the endosperm ( as reviewed in Lopes and Larkins, 1993) However, a newer idea suggests that the t riploid endosperm evolved from what was once maternal nutritive tissue to a biparental nutritive tissue (Williams and Friedman, 2002) Double fertilization occurs in flowering plants and is a process that is unique to angiosperms (Raven et al., 2005) Two f ertilization events occur in which two sperm nuclei from the pollen tube fuse with two female gametes, namely an egg cell and a central c ell containing two polar nuclei (Faure et al., 2003) The latter two ce lls are found in the female reproductive structure, known as the megagametophyte which is located in the ovule The megagametophyte develops from a megasporocyte, which undergoes meiosis to produce four haploid megaspores. Of the four megaspor es, three

PAGE 9

2 will degenerate (Raven et al., 2005) The one megaspore remaining undergoes three rounds of mitosis to produce a multinucleate structure with eight haploid nuclei. T his is the megagametophyte, also known as the embry o sac (Olsen, 2004) Three of the eight haploid nuclei become antipodal cells and form opposite the micropylar opening (Berger et al., 2008) Two nuclei are enclosed in the central cell in the middle, two become synergids and one forms the egg cell near the micropylar opening (Olsen, 2004) (Figure 1) Fusion of the second sperm nucleus with the central cell leads to endosperm for mation. The zygote will develop into the embryo. When the seed germinates, reserves from the endosperm will be mobilized to provide sugars and amino acids to the growing seedling (Sabelli and Larkins, 2009) Figure 1: Diagram of the female reproduct ive structure, the megagametophyte with the pollen tube (yellow structure) and the two sperm nuclei located near the micropylar opening. The red structures represent the synergids; the blue structure represents the egg cell, the orange structure represents the central cell and the green structures opposite the micropylar opening are the antipodal cells (Berger et al., 2008)

PAGE 10

3 1.2 Endosperm Development 1.2.1 Endosperm Coenocyte Fo rmation Maize endosperm is considered a nuclear endosperm because in the beginning of development, the endosperm will develop without cellularization. This type of endosperm development is common in seeds of cereals such as maize, barley, and rice (Lopes and Larkins, 1993) Based on the detailed cytological work that has been conducted in barle y (Brown et al., 1994; Olsen, 2004) along with some similar ob se rvations in maize (Randolph, 1936; Kiesselbach 1999) the following sequence of events has been determined. Early on from 1 day after pollination (DAP) (Figure 2) to 2 DAP there is a n absence of a cell plate between the initial daughter nuclei (Olsen, 2004) Figure 2 : The nuclei of the central cell divide in the absence of cellularization. (Olsen, 2004) Continued m itotic divisions in the absence of cell wall s lead to the development of the endosperm coen ocyte, which is a multinucleate cell (Olsen, 2004) The endosperm has undergone a total of three nu clear divisions and eight endospe rm nuclei have been produced (Figure 3 ). At the end of the coenocytic stage at approximately 2 3 DAP the endosperm will have roughly between 256 512 nuclei that are evenly space d out in the cytoplasm around a temporary c entral vacuole ( Kiesselbach 1999; Olsen, 2004)

PAGE 11

4 Figure 3: The endosperm coenocyte after three rounds of mitosis; still no cellularization (Olsen, 2004) Figure 4 : The complete endosperm coenocyte (Olsen, 2004) 1.2.2 Endosperm Cellularization The process of cellularization has also been most carefully studied in barley (Olsen et al., 1999; Olsen, 2004) with similar observations in maize (Monjardino et al., 2007) The cellularization process begins when the radial microtubular system (RMS) forms nucleating from the envelopes of all the nucle i (Olsen, 2001) These microtubules act as phragmoplasts since they come together and form inter zone s (Olsen, 2004) where cell wal ls are formed and positioned around each n ucleus to form alveoli (Olsen, 2001) Figure 5: Formation of the RMS in the endosperm coenocyte (Olsen, 2004)

PAGE 12

5 Figure 6: Formation of alveoli around each nucleus in the endosperm (Olsen, 2004) After the formation of th e first layer of alveolar nuclei, each nucleus simultaneously breaks mitotic arrest so that they can divid e. T he products are separated by periclinal cell wall s that are adjacent to the central cell wall (Olsen, 2004) The periclinal cell wall s will divide th e alveoli into peripheral cells, each with an additional al veolus (Olsen, 2004) The alveolar nuclei continue dividing until the endosperm becomes completely cellularized which occurs around 4 days a fter pollination, or DAP (Olsen, 2004) Figure 7: Complete cellularization of the maize endosperm after 4 DAP (Olsen, 2004) 1.2.3 Endosperm Differentiation Once the maize endosperm is fully developed, it can be subdivided into four different ce ll types: cells of the embryo surrounding region (ESR), transfer cells (TC) aleurone cells (AL) and starchy endosperm (SE) cells (Olsen, 2004)

PAGE 13

6 Figure 8: The four different cell types of the maize endosperm. EMB is the embryo; ESR is the embryo surrounding region; AL is the aleurone layer, SE is the starchy endosperm; TC are the transfer cells (Olsen, 2001) The ESR, believed to develop first, lines the cavity of the endo spe rm where the embryo develops. I ts function is not known but it is hypothesized to play a role in e mbryo nutrition and/or provides a barrier between the embryo and endosperm during development of the seed (Olsen, 2001) While the embryo matures, the ESR continually shrinks an d around 12 DAP only small ESR remnants remain at the base of the endosperm (Sabelli and Larkins, 2009) This layer may also be a means of defense from pa thogens and signaling between endosperm and embryo (Sabelli and Larkins, 2009) In maize endosperm, the ESR is characterized by dense cytoplasmic contents and expression of three specific ESR genes: E mbryo surrounding region 1 (E sr1 ) Esr2, and Esr3 (Opsahl Ferstad et al., 1997) It has been speculated that ESR genes code for small hydrophilic proteins (Bonell o et al., 2000) and play a role in embryo development since a decrease of Esr expression has been seen in embryo less endosperm (Olsen, 2004)

PAGE 14

7 Transfer cells develop over the main vascular tissue and function to facilitate the transportation of photosynthate into the endosperm (Olsen, 2001) They also regulate the transport of solutes (amino acids, sucrose, and monosaccharides) into the endosperm (Becraft et al., 2001) and are characterized by distinct secondary wall ingrowths (Becraft et al., 2001) In maize endosperm, transfer cells express B asal endosperm transfer cell layer (B e tl ) genes and Basal layer type antifungal protein (Bap) (Hueros et al., 1995) The BETL 1 protein has three possible roles in the endosperm: to protect the seed from pathogens, modification of cell wall characteristics and/or promo ting the addition of cell wall components to the transfer cells (Hueros et al., 1995) BETL 2, BETL3, and BETL 4 proteins have been suggested to play a role in creating a barrier that prevents pathogens from entering the endosperm (Xiong et al., 2011) The Bap proteins are similar to anti microbial proteins, suggesting that they may also play a role in the defense against pathogens (Olsen, 2004) After the transfer cells have developed, the cells of the aleurone layer differentiate between 6 and 10 DAP (Sabelli and Larkins, 2009) The aleurone layer surrounds the perimeter of the endosperm, w ith the exception of the transfer cell region (Olsen, 2001) In maize endosperm, the aleurone layer is only one layer thick and consists roughly of 250,000 cells (Olsen, 2001) T hese c ells have lytic vacuoles and protein storage vacuoles (Swanson et al., 1998) Two types of inclusion bodies are found in both vacuoles : globoid bodies ( composed of phytin, protein, and lipids) and protein carboh ydrate bodies (Olsen, 2001) Aleurone cells secrete proteolytic and hydrolytic enzymes at germination (Olsen, 2001) These enzymes are responsible for digesting endosperm cell walls an d mobilizing

PAGE 15

8 starch and protein from the endosperm to the embryo (Sabelli and Larkins, 2009) Aleurone cells undergo apoptosis once the seed has finished germinating (Olsen, 2001) The starchy endosperm is the largest component of the endosperm (Sabelli and Larkins, 2009) Starch, the main endosperm storage compound, is synthesized by four different classes of enzymes: ADP glucose pyrophosphorylase (AGPase), starch synthases (SS), branching enzymes (BE), and debranching enzymes (Olsen, 2001) Prolamin proteins are the other main storage molecules (Shewry and Tatham, 1990; Mntz, 1998) The first starchy endosperm cells come from two sources: the inner cells present at the end of endosperm cellularization and the inner aleurone daughter cells that have divided periclinally (Olsen, 2004) Starchy endosperm cells go through the process of endoreduplication and eventually an apoptosis like process (Olsen, 2001) Endoreduplication is the process of nuclea r polyploi dization, involving the production of many uniform copies of chromosomes sans chromatin condensation and segregation or cytokinesis (Larkins et al., 2001) 1.3 Description of NSF Funded Project on Early Endosperm D evelopment in Maize As evident in the Introduction thus far, much of what we know about early development in maize has been inferred from work in barle y. T his thesis research was part of a large research effort funded by the National Science Foundation ( NSF) (award # 0923880 ). This is a multi institutional grant that focuses on the regulation of early endosperm devel opment in maize specifically There are four main universities working together on this grant to achieve the main goals of this project : Uni versity of Arizona, University of Utah, Central Michigan University, and New College of Florida. The long

PAGE 16

9 term goal of the grant is to understand the gene networks that control early endosperm development. The gran t focuses mainly on kernels 0 to 12 DAP hom ing in on the early stages In maize, t hese stages have been studied less well than the later stages when starch and storage proteins are deposited ( see Olsen, 2004 and Sabelli and Larkins, 2009 for reviews ) Specifically, t he four main goals of the grant include: (1) analyzing and staging the cytological features of early endosperm development, (2) profiling messenger RNA (mRNA) sequences in early seed developm ent, (3) characterization of expression and (4) assessment of function of selected transcription factor (TF) genes. The majority of this work is being conducted in the inbred line B73, the genome of which has been sequenced (Schnable et al., 2009) In addition, 26 different mapped inbred lines thought to represent the ran ge of natural variation (Buckler e t al., 2009; Yu et al., 2008) ar e also being analyzed for differences they may display in endosperm development. If marked differences are observed, it is possible that loci could be identified that are associated with these differences. Preliminary observations of micrographs of the C ML322 line suggested that the endosperm development was precocious (Clore and Sonchaiwanich preliminary observations) One goal of this thesis wa s to quantitatively measure CML322 endosperm tissue and to compare it to B73 at different stages of developmen t in order to test the hypothesis of precocious development. Profiling of the mRNA sequences is a larger goal of the grant that should allow for identification of active genes in early endosperm development and possibly the d iscovery of TF genes that are key in endosperm development. Characterizing the gene expression patterns will validate the discovered genes and verify their location of

PAGE 17

10 expression. In addition, the research involves testing the hypothesis that 10 to 15 genes already known to be expressed in early Arabidopsis thaliana endosperm may serve a role in maize development as well Many techniques will be utilized for the grant research (NSF Grant Proposal, award #0923880, 2009) The use of basic and advanced types of microscopy (compound, fluorescent, and confocal) as well as in situ hybridization will help detect early developmental events and cellular locations of gene expression in endosperm. L aser capture microdissection ( LCM) is also being used to isolate specific cells an d amplify the transcripts expressed therein Following amplification of the transcripts a form of sequencing, known as deep sequencing, is being used to sequence the RNAs expressed during development Deep sequencing is an efficient way of identifying and profiling populations of mRNAs in tissues at different developmental stages (Fahlgren et al., 2007) Sequences corresponding to transcription factors will be p rioritized for further analysis, starting wit h in situ hybridization to characterize endogenous expression. Eventually, RNA interference (RNAi) will be utilized in order to form stable mutant lines and gene targeting to assess their function of the target ed genes In the end, the general goal of the grant is to expand the basic understanding of the early stages of maize endosperm development. If the defined goals mentioned are accomplished, it will set preced ence as a large contribution to the field of g rain biology Also, breeders may be able to use this information to produce improved lines for both nutritional and industrial applications. However, the grant provides contribution to more than the scientific community. Undergraduate students from all of the universities will be able to gain laboratory techniques and experiences and an education in molecular

PAGE 18

11 genetics of plants. There is also community involvement with local community colleges and K 12 schools. This present study tested one of the tech niques, in situ hybridization, to obtain the optimal conditions for the future characterization of genes identified by the grant. 1.4 Techniques of In Situ Hybridization (ISH) 1.4.1 General Overview of ISH In situ hybridization (ISH) is a technique used in many types of biological research to localize RNA and/or DNA in specific cells using molecular and histological methods (Jin and Lloyd, 1997) It can trace the sites of the expression of specific gene s within a tissue (Wisden and Morris, 2002) ISH is a hybridization reaction between a labeled nucleotide containing probe (e.g. DNA, RNA, or oligonucleotide) and complementary target RNA or DNA sequences (Jin and Lloyd, 1997) The nucleic acid probe can be radioactively labeled and is applied to the tissue section (Wisden and Morris, 2002) Alternatively the probes are labeled with digoxigenin (DIG), a standard immunoh istochemical marker used for in situ hybridization experiments. In the case of ISH to probe for mRNA, o nce the probe has been applied to the tissue, it forms a probe mRNA hybrid (Wisden and Morris, 2002) Detection of the probe is dependent on the If the probe is lab eled with a radioisotope, then autoradiography is typically used to detect the signals (Jin and Lloyd, 1997) This method allows for the quan tification of the signals (Jin and Lloyd, 1997) If the probe is labeled with a non isotope such as with DIG, then histochemical or immunohistochemical systems are used to detect the signals (Jin and Lloyd, 1997)

PAGE 19

12 For example, i n the present study following application of DIG labeled probes and anti DIG antibodies conjugated t o alkaline phosphatase (AP) a colorimetric method was used to visualize the signal and employ ed nitro blue tetrazolium (NBT)/5 bromo 4 chloro 3 indolyl phosphate (BCIP) as substrates. Finally, fluorescence can also be used either via incorporation of fluorescent nucleotides into the probe or via the use of fluorescent a ntibodies or reactive products (Moter and Gbel, 2000) There are a variety of probes that can be used for the in situ hybridization process. These probes include cDNA, cRNA, and synthetic oligonucleotide probes (Jin and Lloyd, 1997) cRNA probes are prepared by in vitro transcription using cDNA sequences as the template (Jin and Lloyd, 1997) cDNA probes can be either double stranded or single stranded; double stranded cDNA probes must first be denatured (Jin and Lloyd, 1997) Single stranded cDNA probes are prepared via polymerase chain reaction (PCR) with an antisense primer extension and Taq polymerase (Jin and Lloyd, 1997) This thesis involved the use of custom made synthetic DIG hyper labeled oligonucleotide probes from the vendor, GeneDetect The use of oligonucleotide probes in an in situ experiment is more recent ; however, it has many advantages. Oligonucleotide probes are only 20 50 bases long and are single stranded. T hese probes are prepared by an automated DNA synthesizer starting with known sequence information of the RNA target (Jin and Lloyd, 1997) Hyper labeled custom ordered probes recently became available for order online ( www.genedetect.com )

PAGE 20

13 The use of oligonucleotide probes is advantageous because they are able to penetrate cells better than longer probes and provide good hybridi zation signals (Jin and Lloyd, 1997) Because all oligonucleotide probes are relatively the same length, the conditions for these probes in the ISH experiment are all roughly the same (Wisden and Morris, 2002) Finally, they can simply be ordered based u pon known mRNA sequence information. If cRNA probes ( which require the gene to be cloned into bacteria and then the probe synthesized through in vitro transcription) were used, each cRNA probe correspond ing to each gene of interest would have its own set of optimal condition s prolonging the trouble shooting stages of the experiment (Wisden and Morris, 2002) However, some researchers feel that RNA probes remain ideal due to their typically high signal to background rat io (Melton et al., 1984) Since a large number of oligonucleotide probes and tissue sections can be handled at once, oligonucleotide probes are good for the parallel study of the expression of several different genes in a specific tissue (Wisden and Morris, 2002) In the present study oligonucleotide probes were used to detect the typically abundant expression of a gamma zein gene in the endosperm tissue of maize. 1.4.2 Gamma Zein as a T est Case In maize kernels there are two types of seed storage protein bodies present: prolamins and globulins (Holding, 2006) Gamma zein is a prolamin protein that is abundantly found in the endosperm of maize (Holding, 2006) Experimental results have shown that gamma zein is highly abundant during endosperm development in maize. Woo and colleagues (2001) showed that the 27 kD a gamma zein gene was expressed in

PAGE 21

14 the endo sperm starting between 10 to 15 DAP (Woo et al., 2001) At 15 DAP, the level of ISH signal was shown to be higher than at 10 DAP and with the least amount of incubation time; this indicate d that gamma zein transcrip t is present at these stages of endosperm development and abundant at 15 DAP (Woo et al., 2001) RNA probe, which had to be synthesized via in vitro transcription, was use d in the above study Zein mRNAs are transp orted to the endoplasmic reticulum where they co translationally assemble into prot ein bodies (Lending and Larkins, 1989) A particular distribution pattern has been shown through immunolocalization techniques (Lending and Larkins, 1989) I mmunolocalization was used to label three types of zein proteins, alpha, beta, and gamma, which are heterogeneously located in tissues at different stages (Lending and Larkins, 1989) Analysis of the endosperm structure at 14 DAP using light microscopy co mbined with immunocytochemistry showed that protein bodies were first observed in the starchy endosperm layer. The protein bodies increased in size the further away the tissue was from the aleurone The staining increased in endosperm tissue at 18 DAP, indicating that the abundance of gamma zein increased from 14 DAP to 18 DAP, and again the size of the protein bodies increased as the distance from the aleurone layer increase d (Lending and Larkins, 1989) Based on their additional immunocytochemical studies combined with electron microscopy a model of protein body development was suggested. During its initial dev elopment, the protein body is mainly composed of beta and gamma zein proteins and very little alpha or delta zein proteins (Lending and Larkins, 1989; Swarup et al., 1995) However, as the prot ein body develops, alpha and delta zein begin to accumulate into a

PAGE 22

15 central core of the protein body while the region of beta and g amma zein transform s into a thin peripheral shell (Figure 9 ) (Lending and Larkins, 1989) Figure 9 : Development of a protein body. The shaded region represent the beta and gamma zeins while the lighter region represents alpha and delta zeins (Swarup et al., 1995) As the protein body develops, the beta and gamma zeins turn into an outer shell while the alpha and delta zeins accumulate at the center of the protein body (Lending and Larkins, 1989) Since the 27 kDa gamma zein mRNA is known to be expressed in the endospe rm between 10 and 15 DAP, it was used as the test case in the ISH experiments in the present study since it should allow for potentially attainable results with the ISH experiments after optimization These exp eriments were conducted on tissue from the CML322 inbred line because it appeared from our preliminary observations that this of 12 DAP CML322 kernels should cert ainly be expressi ng the zeins. As mentioned earlier, t his hypothesis of precocious development was quantitatively tested in the present study via tissue morphometry CML322 morphometry results conducted by the author, were then compared to those in the standard control inbred line, B73, which were obtained as a whole lab effort.

PAGE 23

16 It was not possible to use the Greenstar probe on B73 kernels due to a tissue shortage in the lab at the time the in situ hybridization experiments were being conducted. Greenstar probes were used to characterize the CML322 line without directly comparing its activity on the B73 line in order to determine the optimal conditions for hybridization and staining Using gamma zein as a test case for the use of the DIG hyper labeled oligonucleotide probes should lead to the determination of conditions that can be used, or at lea st serve as a starting place, for future ISH experiments as candidate genes of interest are identified by the NSF project.

PAGE 24

17 CHAPTER 2: MATERIALS AND METHODS 2.1 Overview of Plant Materials M aize kernels from the CML3 22 line were surface sterilized with 10% (v/v) bleach solution for 15 min. After surface sterilization, the kernels were placed between wet paper towels in a Ziploc b ag in a growth chamber to germinate for one week. The kernels were then removed from the paper towels and planted in potting soil (13 L peat moss, 13 L vermiculite, 3.15 L top soil, 9 L sand, and 6.75 L perlite ). The pots were placed in a New College o f Florida greenhouse and were drip irrigated with approximately 100 mL of water per pot per day. Supplemental lighting was use d to h Two fertilizer solutions were used on the CML 322 line. The Southern Ag fertilizer solution consi sted of Southern Ag Power Pack 20 20 20 amended with calcium nitrate (Ca(NO 3 ) 2 ), potassium nitrate (KNO 3 ), and iron ethylen ediaminetetraacetic acid (EDTA). A volume of 300 mL of S outhern Ag fertilizer solution wa s applied three times weekly A volume of 300 mL of 2 mM magnesium sulfate (MgSO 4 ) was applied twice weekly, alternating with the Southern Ag fertilizer solution. 2.2 Tissue Morphometry Technique 2.2.1 Tissue Fixation Vibratome Sectioning, and Staining Before fixation, maize kernels were superficially n icked at the apical end with a double edge razor blade to allow for further penetration of the fixative solution. Maize kernels (1 12 DAP) were placed in 20 mL scintillation vial s containing 4% (v/v)

PAGE 25

18 formaldehyde and 1% (v/v) glutaraldehyde in 50 mM phosp hate buffer pH 7 The kernels were incubated overnight on a tissue rotator and then placed in 4 C. Prior to use, they were rinsed in p hosphate buffer saline (PBS 0.01 M phosphate, 0.0027 M potassium chloride, and 0.137 M sodium chloride pH 7.4 ) three times for 15 min each. K e rnels were then mounted onto a vibratome mounting block using Gel Formula Super Glue For longitudinal sections, the kernel was oriented on one of its lateral surfaces such that the original point of attachment of the kernel to the cob was facing towards the blade. For cross sections, the k ernel was oriented such that its apical end was facing up ward The vibratome was set to produce 200 M thick sections S ections were transferred from the vibratome blade to a 16 well plat e containing 50 mM phosphate buffer in each well. Once all the sections from a kernel had been obtained, they were stained with 0.05% (v/v) Toluidine Bl ue (TBO) solution for 30 sec and then washed with 50 mM phosphate buffer. Stained sections were t hen m ounted onto slides with polyvinyl alcohol (PVA) Dabco (1,4 diazab icyclo 2 2 2 octane) (Banker, G., Goslin, K, 1991) 2.2.2 Morphometry Technique (ImageJ) Micrographs of the longitudinal and cross sections were tak en along with a ruler, using a dissecting microscope ( Olympus SZX ). All sections were measured using the ImageJ (version 1.45s) program from the Natio nal Institutes of Health (NIH). Measurements were made of the entire kernel, the maternal tissue known as the nucellus (if present note that the nucellus ultimately degenerates as the endosperm fills the kernel (Woo et al., 2001) the endosperm, and the embryo (if present /visible ). For longitudi nal sections, measurements of the length, thickness, and area were made fo r each tissue (F igure 10 ). F or cross sections, measurements of the width, thickness, and

PAGE 26

19 area were made fo r each tissue (F igure 11 ). In a c haracteristic longitudinal section, the e mbryo (if present) usually lies to the side of the kernel while in cross sections, the embryo (if present) lies in the center of the kernel (c.f. f ig ure s 10D and 11 D) Figure 10 : Cartoon depictions of l ongitudinal sections of maize kernels and their c ytological measurements. The solid vertical line indicates the length ( at the longest part of the tissue); the dashed horizontal line indicates the thickness ( at the widest part of the tissue). These lines must be perpendicular to each other. (A) The bl ue region represents the sectional area of the whole kernel. (B) The orange region represents the area of the nucellus (if present). (C) The red represents the area of the endosperm. (D) The yellow represents the area of the embryo. Figure 11 : Cartoon depictions of c ross sections of maize kernels and their cytological measurements. The solid horizontal line indicates the width of the tissue (the widest part); the dashed vertical line represen ts the thickness of the tissue. These lines must be perpendi cular to each other. (A) The blue region represents the cross sectional area of the kernel. (B) The orange region represents the area of the nucellus (if present). (C) The red represents the area of the endosperm. (D) The yellow represents the area of t he embryo. Before measurements could be made, the measurement scale had to be set and calibrated To do this a line was drawn between two millimeter line s on the ruler. The

PAGE 27

20 known distance was set to one millimeter. A second line was drawn between the same millimeter line s on the ruler and measured. If the value was between 0.97 and 1.03 millimeters, then each cytological structure could be measured. If the value was below 0.97 millimeters or above 1.03 millimeters, the measurement scale was set again The width, length, and thickness of the endosperm and kernel were measured using ImageJ. From these measurements, the radii were calculated and used in the ellipsoid equation to estimate the percent volume of endosperm (and other tissues) relative to the whole kernel. Standard error was calculated and the was run using SAS JMP (Version 4). 2.3 In Situ Hybridization Methods 2.3.1 Paraffin Embedment 2.3.1.1 Ethanol: Acetic Acid Fixation A fresh ethanol: acetic acid (3:1, v /v) solution was prepared and aliquoted into scintillation vial s CML322 kernels (12 DAP) were fixed in th is ethanol: acetic acid solution at 4 C for a minimum of 4 h to a maximum of 16 h After fixation, the kernels were placed in 75% (v/v) ethanol (EtOH) and stored at 4 C until further use. 2.3.1.2 Dehydration Series To prepare for paraffin embedment, the kernels went through an abbreviated EtOH dehydration series at room temperature on a tissue rotator. The kernels were transferred from the 75% ( v/v) EtOH to 85% EtOH for 3 h followed by treatment in 95% EtOH solution for another 3 h The kernels were then placed in a 100% EtOH change

PAGE 28

21 overnight at room temperature. The second and third 100% EtOH changes were made the next day for 3 h each. 2.3.1.3 Infil tration After the EtOH dehydration series, the kernels were infiltrated in a xylene solution series every 6 h at room temperature on a tissue rotator in a fume hood. The volume ratio s of EtOH (E) to xylene (X) (E:X) for each change were as follows : 75:25, 50:50. 35:75, 0:100, 0:100, and 0:100 (second change) In the last E:X change, ten Paraplast chips were added to each vial and left on a tissue rotator overnight. The next day, the vials were placed at 60 C to allow the remaining Paraplast chips to m elt. Once all the chips h ad melted, the xylene was replaced with paraffin. The first two changes consisted of new half volume paraffin changes, once per day. For the next three to four days, the kernels were passed through 100% paraffin change s, once pe r day. 2.3.1.4 Embedment Plastic p araffin molds were wiped away with RNase Away and vials containing paraffin and kernels were placed in a 60 C water bath on the hot plate before the embedment process. A beaker of melted paraffin was also placed on the hot plate. The m olds were filled with liquid paraffin to the lip of the mold and placed on a hot plate to prevent paraffin from solidifying. Forceps were flamed and then used to transfer one kernel fro m the paraffin vial to the paraffin mold. The kernels were oriented so that they were resting on one of their lateral surfaces at the bottom of the mold A glass pipette was flamed and then used to transfer 5 mL paraffin from the beaker to the mold, form ing a convex surface A spatula was flamed and then used to go over the melted paraffin to

PAGE 29

22 rid of any air bubbles. The filled paraffin mold was then carefully transferred to ice and the spatula was wiped over the upper paraffin surface a few more times b efore solidification. After all the kernels were embedded, they were stored in the 4 C until needed for sectioning. 2.3.2 Microtome Sectioning Paraffin molds were removed form the 4 C refr igerator and placed on an ice pack that was wiped with RNase Away A brand new single edged razor blade was used to trim the mold into a trapezoid shape surrounding the kernel. The top and bottom of the trapezoid were made to be p arallel with each other and the blade of the microtome. It was found that t he sides of trapez oid need ed to be almost square (not too oblique) for proper sectioning (F igure 12 ). Once the block had been trimmed, it was placed into the microtome. The blade was wiped with RNase A way as were the paint brushes and probes. The microtome was set to make 8 m thick section s. Before sectioning the face of the block was trimmed to en sure that it was flat and completely parallel to the blade. An ice block was held up against the face of the block for 30 sec. The handle was continuously turned, moving the block closer and closer to the blade until the blade made an initial cut. These preliminary cuts which were discarded, were made until the face of the mold was shiny.

PAGE 30

23 Figure 12 : Diagram of the trapezoidal trimming of the face of the paraffin blo ck The dashed shape represents the trapezoid that should surround the kernel (shaded region). Ribbons consisting of approximately 80 sections were made and laid onto Parafilm These ribbons were cut into mini ribbons, containing approximately four sec tions each. Once the series sectioning was complete, all the mini ribbons were placed in Parafilm in shallow boxes, which were then placed in drawers to avo id dust and RNase contamination These mini ribbons were stored at room temperature until h ematox ylin staining (to initially visualize the tissue) or in situ hybridization. 2.3.3 Hematoxylin Staining Paraffin s ections were baked onto poly D l ysine coated slides overnight at 60 C. The following morning, the slides were placed in two 30 mL xylene rinses in Coplin jars for 10 min each. The xylene rinse s removed the paraffin from the surrounding tissue and a hydration series followed the xylene washes. The slides were first placed in two 30 mL 100% EtOH rinse s for 3 min each followed by rinses consisting of 95% (v/v) and 80% (v/v) EtOH for 3 min each. The sli des were washed for 5 min each in 30 mL distilled water and then placed in dihydroindeno[2,1 c]chromene 3,4,6a,9,10(6H) pentol) for 30 min The slides were then rins ed in lightly running water for an additional

PAGE 31

24 30 min and then in nanopure water for 5 min A dehydration series followed the rinses. The slides were placed in a 30 mL 70% EtOH rinse for 2 min and then in two 30 mL 95% (v/v) EtOH rinses for 2 min each. A fterwards, the slides were transferred to 3 0 mL of 100% EtOH for 1 min and then placed in two changes of 30 m L 100% fresh xylene, 2 min each. The sect ions were mounted with Permount and a coverslip and allowed to dry before observation. 2.3.4 Probe Information The custom made GreenStar TM digoxigenin ( DIG ) hyper labeled antisense oligonucleotide probe ordered from the vendor GeneDetect ) was complimentary to nucleotides 548 595 of the 27 kilodalton (kD) gamma zein mRNA from Zea mays The 48bp sequence of the antisense oligonucleotide DIG GCGTCGTGGCCA TGGTCCGCTAGAAGCCGAACCAGGAGGTCAGGTAGG A DIG hyperlabeled sense probe (negative control) and a poly (dT) probe (positi ve control) were also used. The latter probes were also obtained from Ge neDetect 2.3.5 In Situ Hybridization In preparation for hybridization, p araffin sections were first baked overnight at 60 C. For each of the several runs, f our slides were prepared at a t ime: two slides to be probed with the DIG hyper labeled antisense probe, one slide for the negative control probe and one slide for the positive control probe The slides were then placed in three 100% xylene washes, 2 min each, to remove the paraffin from the surrounding tissue. At the same time, a water bath was set to 37 C and the pre hybridization solution (4 mL 20X SSC, 4 g Dextran sulphate, 10 mL Formamide, 0.5 mL PolyA, 0.5 mL ssDNA, 0.5

PAGE 32

25 mL tRNA, 2 mL DTT, and 0.2 mL 50X Denhardts in a total volume of 17.7 mL ) was placed in the water bath. After the xylene washes, t he slides went through the following hydration series: two 30 mL 100% EtOH washes, 2 min each, 30 mL 95% (v/v) 70% (v/v) and 50% (v/v) EtOH washes for 5 min each two quick washes in nanopure water, and two phosphate buffered saline (PBS) (pH 7.4) washes for 5 min each. The sections were post fixed in 4% (v/v) formaldehyde for 15 min After the post fixation, the slides were placed i n three PBS washes, 5 min each. Slides were first transferred to 30 mL fresh 0.1M (w/v) t riethanolamine (TEA) buffer for t he acetylation step (to block non specific binding) A volume of 75 L of acetic anhydride was added to the buffer to a final concentration of 0.25% (v/v). The slides were incu bated at room temperature for 5 min and afterwards, an additional 75 L of ace tic anhydride was added to reach a final concentration of 0.5% (v/v) after which t he slides were incubated at room temperature for 5 min The slides were washed in 30 mL 2X saline sodium citrate (SSC) for 3 min and then washed in two 30 mL PBS washes for 5 min each. A pre hybridization chamber was created and used for the rest of the in situ hybridization protocol, unless otherwise noted. An overturned 1.5 mL plastic micro centrifuge rack was placed inside a Tupperware container containing moist paper t owels on the bottom. The slide s were then placed on the micro centrifuge rack and 200 L of the pre hybridization solution was pipetted onto each slide. Each slide was then covered with a strip of Parafilm about the size of the tissue ribbon The lid was placed on the container and the slides were incubated at 37 C for 2 h

PAGE 33

26 During the pre hybridization incubation period, the hybridization solutions for the DIG labeled anti sense probe negative (sense) control, and positive (poly T) control were prepared all to a final probe concentration of 200 ng/mL. After t he pre hybridization solution was re moved, the slides were placed in a 2X S S C wash for 5 min A volume of 200 L of the hybridization solution was pipetted onto the slides. The slides were covered with strips of Parafilm and incubated at 37 C overnight in the pre hybridization chamber. The next day, the slides were removed from the oven and brief ly wash ed with 200 L of 1X SSC, 10 mM dithiothreitol (DTT) at room temperature (RT). At 55 C, the slides were washed with two 200 L 1X SS C, 10 mM DTT washes for 15 min each. Two 200 L 0.25X SSC, 10 mM DTT washes followed, 15 min each at 55 C. The last two 200 L 0.25X SSC, 10 mM DTT washes were performed at RT on a rotator. The slides were covered with strips of Parafilm after each wash. After the 0.25X SSC, 10 mM DTT washes, the slides were washed in three 30 mL Tris buffered saline (TBS) washes, 5 min each. On a rotator and in coplin jars, slides were blocked in a blocking solution con sisting of Triton (X 100) + TBS (TTBS) and 1% normal sheep serum for 30 min. After 30 min, the slides were then incubated with an anti DIG alkaline phosphatase (AP) antibody solution (200 L antibody in 1 mL TTBS + 1% normal sheep serum) for 4 hr. During this incubation, the s lides were covered with Parafilm and placed on the rotator. After antibody treatment the slides were placed in C oplin jars on a rotator and were wash ed in two 30 mL TBS washes, 5 min each. A quarter tablet (Sigma) of a nitro blue t etrazolium (NBT)/5 bromo 4 ch loro 3 indolyl phosphate (BCIP) was

PAGE 34

27 dissolved in 2.5 mL dH 2 O containing 2.5 L of stock 1 M l evamisole solution (to inhibit any endogenous alkaline phosphatase activity A volume of 100 L of the color solution was pipetted on top of the tissue sections and allowe d to sit for 5 10 min or until color appeared. To stop the color reaction, the stained slides were plac ed in tap water for 5 min After the color reaction had been stopped, a dehydration series was performed in Copli n jars. Slides were placed in 30 mL of: 30% EtOH, 50% EtOH, 70% EtOH, 90% EtOH, 95% EtOH for 5 min e ach. Two 5 min 100% EtOH washes, a 5 min 1:1 EtOH: xylene wash, and two 5 min xylene washes followed. After the dehydration series, the slides were mount ed with Permount and cover slipped. They were allowed to dry before observation. A schematic diagram depicting the hybridization and color reaction steps is shown in Figure 1 3 Figure 13 : Depiction of the hybridization and color reactions Tissue containing the target RNA sequence (black solid line) had a nucleotide containing probe (red dashed line) labeled with DIG (green circle) applied to it. An anti DIG antibody conjugated with alkaline phosphatase ( AP ) was applied to the tissue and bound to the DIG molecule. A NBT/BCIP substrate solution was applied and produced a precipitate (purple diamonds) that stained the local area of tissue containing the target RNA bluish purple. Only o ne ( or a few ) of each type of molecule is shown for th e sake of clarity.

PAGE 35

28 2.3.6 Controls: In Situ Hybridization with RNase Solution An in situ hybridization expe riment was performed with RNase solution which should destroy endogenous RNAs, as another negative control Two such slides were prepared, one for the co lor reaction containing l evamisole and the other for the color reaction without l evamisole. After the slides were post fixe d in 4% formaldehyde for 15 min and then wash ed three times in PBS for 5 min each, they were incubated in 200 L of RNase solution (1 mg/mL RNase in 2 L 1M Tris, 0.2 L EDTA, and 189.8 L water) for 1 hr at 37 C. The pre hybridization step following the RNase incubation was the same as described previously For each slide, 5 L of the DIG labeled antisense probe was added to 245 L of pre hybridization solution. A volume of 200 L of the hybridization solution was pipetted onto each slide They were then covered with strips of Parafilm and incubated overnight at 37 C. The rest of the in situ hybridization steps were the same as those described previously

PAGE 36

29 CHAPTER 3: RESULTS Two major components of the results were the morphometry measurements for use in comparing endosperm growth in CML322 vs. B73 lines and in situ hybridization results for localizing the 27 kDa gamma zein transcript as a test case CML322 was used in the in situ experiments due to its seemingly precocious development in preliminary studies; this hypothesis of precocious development was first tested in the present study using vibratome sectioning and digital morphometry over the first several days after pollination (DAP) 3.1 Morphometry Results I mages from the vibratome sections of CML 322 and B73 show that although development looks similar early on in CML 322 endosperm (and embryo) development appears to be more advanced in CML 322 versus the standard control line, B73 starting at about 7 DAP Figure 14 shows the development between CML322 and B73 at 1, 3, 4, and 5 days after pollination (D AP) while F igure 15 compares the development between CML322 and B73 at 7, 9, and 12 DAP.

PAGE 37

30 Figure 14 : B73 and CML 322 kernels at 1, 3, 4, and 5 DAP. (A D) represent longitudinal sections of B73 at 1, 3, 4, and 5 DAP, respectively. (E H) represe nt longitudinal sections of CML 322 at 1, 3, 4, and 5 DAP, respectively. The yellow stars represent the endosperm tissue. Magnification bars are all 1mm each. Photography of B73 by Mr. Jo el Thurmond; phot ography of CML 322 by author. Figure assembled by author. 30

PAGE 38

31 Figure 15 : B73 and CML 322 kernels at 7, 9, and 12 DAP. (A C) represent longitudinal sections of B73 at 7, 9, and 12 DAP, respectively. (D F) represe nt longitudinal sectio ns of CML 322 at 7, 9, and 12 DAP. The yellow stars represent the endosperm tissue while the pink arrows are pointing to the embryo (if present/in the plane of section). Magnification bars are all 1mm each. Photography of B73 by Mr. Jo el Thurmond; photogr aphy of CML 322 by author. Figures assembled by author. 3 1

PAGE 39

32 There is also a significant difference in the nucellus development between CML322 and B73, starting at 7 DAP. At 7 DAP, the nucellus in CML 322 is nearly degraded while the nucellus in B73 can still be seen At 12 DAP, the nucellus in CML 322 is considered completely degraded while it is still very much present in B73. Morphometri c measurements were made of CML 322 and B73 kernels. The measurements also suggest that compared to the B73 line, the endosperm and embryo of the CML 322 line occupy a larger proportion of the kernel volume at comparable DAPs (c.f. Fig ures 16 and 17 ) while the nucellus degenerates earlier. The actual endosperm volumes for each line at e ach DAP are shown in Figur e 18 and again, the growth curves appear to diverge, starting at around 7 DAP. The differences in volume between the two lines were statistically significant at 5, 7, 9, 11, and 12 DAP test ( =0.05). This study proceeded with CML 322 kernels for in situ hybridization since its develop ment seemed somewhat precocious; therefore, gamma zein expression would very likely be present by 12 DAP (the l atest stage of kernels harvested for the purpose of this study ).

PAGE 40

33 Figu re 16 : Proportions of total kernel volume occupied by different tissues in B73 from 0 to 12 DAP. Purple bars represent percent volume of embryo (top of the 12 DAP bars) Red bars represent percent volume of nucellus. Blue bars represent volume percentag e of endosperm. Green bars represent percent volume of remaining maternal tissue. 3 3

PAGE 41

34 Figure 17 : Proportions of total kernel volume occupied by different tissues in CML322 from 0 to 12 DAP. Purple bars represent percent volume of embryo. Red bars represent percent volume of nucellus. Blue bars represent volume percentage of endosperm. Green bars r epresent percent volume of remaining maternal tissue. 3 4

PAGE 42

35 Figure 18 : E ndosperm volume for B73 and CML322 at each DAP. The asterisks indicate that endosperm volume s are statistically different between the two line ( =0.05). 3 5

PAGE 43

36 3.2 In situ Hybridization Results 3.2.1 Hematoxylin Staining Results H ematoxylin stain ing results show that ethanol:acetic acid fixation and paraffin infiltration were reasonably effective at preserving the integrity of the kernel tissues despite the lack of cross linking fixative. Thus the tissue was deemed suitable for conducting the in situ hybridization experiments (Figure 19 ). Figure 19 : Hematoxylin stained 12 DAP CML 322 tissue. Though large bubbles in the mounting medium are present, the images nonetheless indicate that the majority of the tissue was structurally well pres erved. The dark oval in figure (B) represent s the developing embryo. The yellow stars represent the endosperm tissue. Some vascular tissue can also be seen in (A) see pink arrow. 3.2.2 In S itu Hybridization Troubleshooting Results The GeneDetect probe company suggested a n optional permeabilization step. The first few in situ hybridization (ISH) runs included slides that received no permeabilization treatment and slides that were subjected to a proteinase K permeabilization treatment (data not shown) Comparing the two tissue sample sets it

PAGE 44

37 was decided that the tissue appear ed degraded with the proteinase K permeabilization treatment. Thus, all subsequent ISH runs contained no permeabilization step. Early on, an optional acetylation step, which should in theory prevent non specific binding of the probes, was tested for eff iciency along with addition of l evamisole to decrease non specific staining caused by remaining endogenous alkaline phosphatase activity (Figure 20 ) The tissue in F igure 20 A (minus acetylation and levamisole ) was stained more darkly (particularly in the embryo) than that in figure 20 B (plus acetylation and levamisole ) which indicated that the addition of these steps resulted in decreased background staining of the tissue samples Therefore, all subsequent results were obtained from experiments in which the se step s were used. Figure 20 : Comparison of tissue in the embryo and immediate surrounding region, which should have minimal 27 kD gamma zein expression (Woo et al., 2001) with and without acetylation and levamisole (A) CML 322 tissue from 12 DAP that received no acetylation and levamisole treatment and was probed with the antisense probe (B) CML 322 tissue from 12 DAP that received acetylation and levamisole treatment and was probed with the antisen se probe The magnification bars in figures (E H) are 200 m

PAGE 45

38 ISH experiments were run on CML322 tissues from 12 DAP with the antisense, sense, and polyT probes (Figure 21). The tissue samples containing the polyT probe stained the darkest because th e polyT probe should bind to any mRNA sequence within the tissue (Figure 21E and F). The tissue samples probed with the sense probe stained very faintly (Figure 21C and D). The upper endosperm tissue treated with RNase solution shows starch present in th e tissue, but little staining (Figure 21G). The lower endosperm tissue and embryo stained very lightly (Figure 21H) and have little inherent contrast since there is less starch stored in the region.

PAGE 46

39 Figure 21 : ISH experiments on 12 DAP CML 322 tissue using antisense, sense, and poly T probes. (A) upper endosperm tissue with antisense gamma zein probe; (B) lower endosperm tissue plus embryo with antisense gamma zein probe; (C) upper endosperm tissue with sense probe (negative control) ; (D) lowe r endosperm tissue plus embryo with sense probe (negative control) ; (E) upper endosperm tissue with poly T probe (positive control) ; (F) lower endospe rm tissue plus embryo with poly T probe (positive control) ; (G) upper endosperm tissue treated with RNase solution and probed with gamma zein probes ; (H) lower endosperm tissue plu s embryo treated with RNase solution and probed with gamma zein probes Micrographs representative of 5 kern els per antisense treatments, 5 kernels per sense treatment s 5 ker nels per polyT treatment, and 2 kernels per RNase treatment. The magnificati on bars are 2 00 m. 3 9

PAGE 47

40 CHAPTER 4: DISCUSSION AND FUTURE DIRECTIONS 4.1 Discussion of Morphometry Results The percent volume for both e ndosperm and embryo is smaller than that of CML 322 toward the second half of the developmental series (c.f. F ig ures 16 and 17 ). In B73, t he nucellus starts small and gradually begins to grow until 7 DAP but then decreases due to its degradation as the endosperm grows to fill t he kernel (Figures 15 and 16) In CML322, the nucellus volume is greatest at 4 DAP and largely degraded by 9 DAP and almost completely degraded by 10 DAP, while at 11 and12 DAP it is nearly non existent (Figures 15 and 17). Comparatively, the nucellus pe rsists for much longer in B73 than in CML 322. In both lines, t he endosperm begins to increase in volume around 7 8 DAP and from there, increases until 12 DAP (Figure s 16, 17, and 18 ). However, starting at 7 DAP, the volume of the endosperm in CML 322 rise s more steeply than in B73 (particularly evident in Figure 18) The embryo was clear in very few B73 kernel sections but was quite visible in many sections of the CML322 series as early as 4 DAP (Figure 17) From the results of the S tudent test ( =0.05), the differences in endosperm volume at 5, 7, 9, 11, and 12 DAP between the lines are statistically signi ficant. From all of the above data it can be concluded that the CML322 kernels develop precociously as compared to the B73 kernels under our g rowth conditions at N ew C ollege of F lorida (NCF) Since the CML 322 kernels growing at the University of Arizona do not show this discrepancy in growth ( personal communication between Dr. Clore and Dr. Yadegari ), it

PAGE 48

41 is possible that environmental factors ma y play a role for growth and development at NCF To test this theory, future experiments mimicking should be conducted as will be discussed later in the Future D irections section De spite the discrepancy between the development of CML 322 and B73 kernels in different locales Florida grown CML 322 kernels were deemed ideal for in situ hybridization experiments because of its precocious development and therefore presumed relatively stro ng expression of the 27 kDa gamma zein 4.2 Discussion of In situ Hybridization Results Figures 18E and 18F were in situ hybridization (ISH) results for the poly T probe (positive control) and resulted in the darkest stain ing. This was expected since the poly T probe was used as the positive control to ensure that there was mRNA present in the tissue. Figures 18C and 18D show results for the sense probe (negative control) which resulted in the lightest staining The sense probe contains the sequence fro m the actual 27 kD gamma zein mE NA and should not hybridize to endogenous zein mRNAs since it is not complementary. Any staining is likely due to minimal non specific binding. Figures 18A and 18B show ISH results for the antisense probe, resulting in a st aining intensity that was between that of the negative and positive control. The antisense probe contains the sequence that is complementary to the gamma zein mRNA; therefore, it should only specifically bind to the gamma zein mRNA if present in the tiss ue. S taining pattern s suggest that the antisense probe bound specifically to the gamma zein mRNA. The intensity of the staining was mainly concentrated in the apical region of

PAGE 49

42 the kernel, which is expected since there are higher levels of gamma zein mRNA in this region (Woo et al., 2001) Figures 18G and 18H show ISH results of an in situ hybridization experiment on RNase treated tissue This was done to confirm that the antisense probes were primarily binding to RNA. The visible circular bodies in the apical region do not represent staining, but rather are starch granules present in the upper endosperm. A relatively low level of staining was expected since endogenous mRNAs should no longer be present. Overall, n ot only did these in situ experiments allow the optimal conditions (i.e., hybridization temperature at 37 C, omission of permeabilization, treatment with levamisole, and addition of acetylation .) to be identified, but it also showed that Greenstar TM probe s work for abundant transcripts located in the tissue 4.3 Future Direction s 4.3.1 Determining the Environmental Factors Responsible for the Rapid Endosperm Development in CML322 Since CML322 grown in the greenhouses at University of Arizona does not show the sam e rapid increase in endosperm volume, it would be best to mimic the conditions (temperature, humidity, irrigation times and amounts) of s to see if their results can be duplicated If the ir results are reproducible, the n it is possible that it is environmental factors that are causi ng the development al precociousness although there may be an underlying genetic program that is triggered by environmental factors. I t would be best if this experiment was conducted at the University of Utah since they have growth rooms where the specific temperature light and humidity levels can be

PAGE 50

43 feasible. (NCF growth conditions would b e more difficult to mimic since our temperatures are much more variable due to lack of significant temperature control). Perhaps different variables (i.e., humidity) could then be changed systematically to see if precocious development can be triggered. If it can with regularity, then it might be worthwhile to see if any known loci of the mapped line correlate with this tendency 4.3.2 Location of Target Genes, Transcription Factors, and Marker Genes Now that optimal conditions for ISH have been achieved with t hese probes we can begin to use the technique to probe for target genes such as transcription factors and marker genes Marker genes have been discovered that are abundant and should be useful for tissue identification Some of these marker genes appear to be endosperm specif ic based upon PCR studies (personal communication between Dr. Clore, Dr. Drews, and Dr. Yadegari) and this can be verified via ISH experiments ISH can also be used to d etermine where in the kernel other marker genes are expressed. What is beneficial about using Greenstar TM probes is that they can be ordered simply based upon known sequence information and come with positive and negative control probes Greenstar TM also makes triple labeled DIG probes available for transcripts tha t are rare and require increased sensitivity which should be useful for probing for transcription factor mRNAs Unfortunately, probes from Greenstar TM are currently unavailable as the company is negotiating with a larger company. cRNA probes may have to be used for future in situ experiments; however, the synthesis of cRNA probes is rather tedious and time consuming. However, if different types of probes

PAGE 51

44 (such as cRNA probes) must be used in the ISH, similar conditions could still be applied to the ISH e xperiments. For example, we know which permeabilization condition not to use and that acetylation and levamisole should be included to decrease background staining. 4.3.3 ISH Comparison of B73 and CML 322 N o B73 kernels were available for preparation of ISH due to their use in other grant research. B73 kernels are issued fro m the Maize Genetics Cooperative Stock Center in very limited quantities. Therefore, ISH could not be done on B73 kernels to compare to CML322 kernels. ISH experiments conducted on B73 would determine if the precocious development in CML322 included the increased production of gamma zein or just cellular proliferation Once the lab is able to receive more B73 seeds by bulking, this experiment to compare the gamma zein transcript produc tion can be conducted. 4.3.4 Limitation of Formula for Endosperm Volume The formula to calculate the volume of the endosperm, was generated from the formula for the volume of an ellipsoid. However, this formula likely overestimates the ac tual volume of the endosperm, especially around 4 or 5 DAP. During this stage, the endosperm generally has a bottle shape (Figure 13D) so the ellipsoid formula would overestimate the volume, particularly of the apical portion Devising a formula (or for mulas) that more accurately estimate s the endosperm volume would be beneficial and could help to verify that endosperm development in CML 322 is precocious compared to B73.

PAGE 52

45 4.4 Overall Summary In conclusion, although the observation that CML322 endosperm deve lops precociously was not confirmed in Arizona, these findings may lead to interesting information about environmental triggers for enhanced endosperm and embryo growth. In a d dition, a set of conditions has been identified for use with Greenstar TM probes which should prove to be very useful, particularly if these probes return to the m arket. Some of the information learned (i.e., that permeabilization is damaging, that acetylation blocks non specific binding, and that endogenous alkaline phosphata se activity needs to be inhibited) should prove useful even if cRNA probes must be used.

PAGE 53

46 REFERENCES Banker, G., Goslin, K (1991). Characterizations and studying neuronal cultures. 75 118. Becraft P.W., Brown R.C., Lemmon B.E., Olsen O.A. and Opsahl Ferstad H.G. (2001). Endosperm Development. 353 357. Berger F., Hamamura Y., Ingouff M., and Higashiyama T. (2008). Double fertilization: caught in the act. Trends in Plant Science 13, 437 443. Bonello J., Opsahl Ferstad H., Perez P., Dumas C., and Rogowsky P.M. (2000). Esr genes show different levels of expression in the same region of maize endosperm. Gene 246, 219 227. Brown R.C., Lemmon B.E., and Olsen O.A. (1994). Endosperm Development in Barley: Microtubule Involvement in the Morphogen etic Pathway. The Plant Cell Online 6, 1241 1252. Buckler E.S., Holland J.B., Bradbury P.J., Acharya C.B., Brown P.J., Browne C., Ersoz E., Flint Garcia S., Garcia A., Glaubitz J.C., Goodman M.M., Harjes C., Guill K., Kroon D.E., Larsson S., Lepak N.K., L i H., Mitchell S.E., Pressoir G., Peiffer J.A., Rosas M.O., Rocheford T.R., Romay M.C., Romero S., Salvo S., Villeda H.S., Sofia da Silva H., Sun Q., Tian F., Upadyayula N., Ware D., Yates H., Yu J., Zhang Z., Kresovich S., and McMullen M.D. (2009). The Ge netic Architecture of Maize Flowering Time. Science 325, 714 718.

PAGE 54

47 Fahlgren N., Howell M.D., Kasschau K.D., Chapman E.J., Sullivan C.M., Cumbie J.S., Givan S.A., Law T.F., Grant S.R., Dangl J.L., and Carrington J.C. (2007). High Throughput Sequencing of Ar abidopsis microRNAs: Evidence for Frequent Birth and Death of MIRNA Genes. e219. Faure J., Rusche M.L., Thomas A., Keim P., Dumas C., Mogensen H.L., Rougier M., and Chaboud A. (2003). Double fertilization in maize: the two male gametes from a pollen gra in have the ability to fuse with egg cells. 33, 1051 1062. Holding D.R. (2006). The Development and Importance of Zein Protein Bodies in Maize Endosperm. 51, 243 254. Hueros G., Varotto S., Salamini F., and Thompson R.D. (1995). Molecular Characterizatio n of BET1, a Gene Expressed in the Endosperm Transfer Cells of Maize. The Plant Cell Online 7, 747 757. Jin L. and Lloyd R.V. (1997). In situ hybridization: Methods and applications. J. Clin. Lab. Anal. 11, 2 9. Ki e sselbach T.A. (1999). The Structure and Reproduction of Corn(Cold Spring Harbor, NY). Larkins B.A., Dilkes B.P., Dante R.A., Coelho C.M., Woo Y., and Liu Y. (2001). Investigating the hows and whys of DNA endoreduplication. Journal of Experimental Botany 52, 183 192.

PAGE 55

48 Lending C.R. and Larkins B .A. (1989). Changes in the Zein Composition of Protein Bodies during Maize Endosperm Development. The Plant Cell Online 1, 1011 1023. Lopes M.A. and Larkins B.A. (1993). Endosperm Origin, Development, and Function. The Plant Cell Online 5, 1383 1399. Melton D.A., Krieg P.A., Rebagliati M.R., Maniatis T., Zinn K., and Green M.R. (1984). Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Research 12, 70 35 7056. Monjardino P., Machado J., Gil F.S., Fernandes R., and Salema R. (2007). Structural and ultrastructural characterization of maize coenocyte and endosperm cellularization. Canadian Journal of Botany 85, 216. Moter A. and Gbel U.B. (2000). Fluore scence in situ hybridization (FISH) for direct visualization of microorganisms. J. Microbiol. Methods 41, 85 112. Mntz K. (1998). Deposition of storage proteins. Plant Mol. Biol. 38, 77 99. NSF Grant Proposal, award #0923880 (2009). TRMS: Reguation of e arly endsperm development in maize. 0923880, Olsen O. (2001). Endosperm development: Cellularization and cell fate specification. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52, 233

PAGE 56

49 Olsen O., Linnestad C., and Nichols S.E. (1999). Developmental biology of the cereal endosperm. Trends Plant Sci. 4, 253 257. Olsen O. (2004). Nuclear Endosperm Development in Cereals and Arabidopsis thaliana. The Plant Cell Online 16, S214 S227. Opsahl Ferstad H., Deunff E.L., Dumas C., and Rogowsky P.M. (1997). ZmEsr, a novel endosperm specific gene expressed in a restricted region around the maize embryo. 12, 235 246. Randolph L.F. (1936). Developmental Morphology of the Caryopsis in Maize. 53, 881 916. Raven P.H., Evert R.F., and Eichhorn S.E. (2005). Biology of plant s(: W.H. Freeman and Company). Sabelli P.A. and Larkins B.A. (2009). The Development of Endosperm in Grasses. Plant Physiology 149, 14 26. Schnable P.S., Ware D., Fulton R.S., Stein J.C., Wei F., Pasternak S., Liang C., Zhang J., Fulton L., Graves T.A., Minx P., Reily A.D., Courtney L., Kruchowski S.S., Tomlinson C., Strong C., Delehaunty K., Fronick C., Courtney B., Rock S.M., Belter E., Du F., Kim K., Abbott R.M., Cotton M., Levy A., Marchetto P., Ochoa K., Jackson S.M., Gillam B., Chen W., Yan L., Higg inbotham J., Cardenas M., Waligorski J., Applebaum E., Phelps L., Falcone J., Kanchi K., Thane T., Scimone A., Thane N., Henke J., Wang T., Ruppert J., Shah N., Rotter K., Hodges J.,

PAGE 57

50 Ingenthron E., Cordes M., Kohlberg S., Sgro J., Delgado B., Mead K., Chin walla A., Leonard S., Crouse K., Collura K., Kudrna D., Currie J., He R., Angelova A., Rajasekar S., Mueller T., Lomeli R., Scara G., Ko A., Delaney K., Wissotski M., Lopez G., Campos D., Braidotti M., Ashley E., Golser W., Kim H., Lee S., Lin J., Dujmic Z ., Kim W., Talag J., Zuccolo A., Fan C., Sebastian A., Kramer M., Spiegel L., Nascimento L., Zutavern T., Miller B., Ambroise C., Muller S., Spooner W., Narechania A., Ren L., Wei S., Kumari S., Faga B., Levy M.J., McMahan L., Van Buren P., Vaughn M.W., Yi ng K., Yeh C., Emrich S.J., Jia Y., Kalyanaraman A., Hsia A., Barbazuk W.B., Baucom R.S., Brutnell T.P., Carpita N.C., Chaparro C., Chia J., Deragon J., Estill J.C., Fu Y., Jeddeloh J.A., Han Y., Lee H., Li P., Lisch D.R., Liu S., Liu Z., Nagel D.H., McCan n M.C., SanMiguel P., Myers A.M., Nettleton D., Nguyen J., Penning B.W., Ponnala L., Schneider K.L., Schwartz D.C., Sharma A., Soderlund C., Springer N.M., Sun Q., Wang H., Waterman M., Westerman R., Wolfgruber T.K., Yang L., Yu Y., Zhang L., Zhou S., Zhu Q., Bennetzen J.L., Dawe R.K., Jiang J., Jiang N., Presting G.G., Wessler S.R., Aluru S., Martienssen R.A., Clifton S.W., McCombie W.R., Wing R.A., and Wilson R.K. (2009). The B73 Maize Genome: Complexity, Diversity, and Dynamics. Science 326, 1112 1115. Shewry P.R. and Tatham A.S. (1990). The prolamin storage proteins of cereal seeds: structure and evolution. 267

PAGE 58

51 Swanson S.J., Bethke P.C., and Jones R.L. (1998). Barley Aleurone Cells Contain Two Types of Vacuoles: Characterization of Lytic Organelles by Use of Fluorescent Probes. The Plant Cell Online 10, 685 698. Swarup S., Timmermans M.C.P., Chaudhuri S., and Messing J. (1995). Determinants of the high methionine trait in wild and exotic germplasm may have escaped selection during early cultivation of maize. The Plant Journal 8, 359 368. Williams J.H. and Friedman W.E. (2002). Identification of diploid endosperm in an early angiosperm lineage. Nature 415, 522 526. Wisden W. and Morris B.J. (2002). In situ hybridization with oligonucleotide probes In International Review of NeurobiologyVol. Volume 47, Brian J. Morris William Wisden, ed (: Academic Press) pp. 3 59. Woo Y., Hu D.W., Larkins B.A., and Jung R. (2001). Genomics Analysis of Genes Expressed in Maize Endosperm Identifies Novel Seed Proteins and Clarifies Patterns of Zein Gene Expression. The Plant Cell Online 13, 2297 2317. www.genedetect.com GENEDETECT (R) a leading supplier of products and services to acadmemic and government research institutions as well as a pharmaceutical and biotechnology companies. 2011, Xiong Y., Li Q., Kang B., and Chourey P. (2011). Discovery of Genes Expressed in Basal Endosperm Transfer Cells in Maize Using 454 Transcriptome Sequencing. Plant Mol. Biol. Rep. 29, 835 847.

PAGE 59

52 Yu J., Holland J.B., McMullen M.D., and Buckler E.S. (January 2008). Genetic Design and Statistical Power of Nested Association Mapping in Maiz e. Genetics 178, 539 551.


ERROR LOADING HTML FROM SOURCE (http://ncf.sobek.ufl.edu//design/skins/UFDC/html/footer_item.html)