ERROR LOADING HTML FROM SOURCE (http://ncf.sobek.ufl.edu//design/skins/UFDC/html/header_item.html)

Population Connectivity of the Acropra Palmata on Cayos Cochinos, Honduras

Permanent Link: http://ncf.sobek.ufl.edu/NCFE004374/00001

Material Information

Title: Population Connectivity of the Acropra Palmata on Cayos Cochinos, Honduras
Physical Description: Book
Language: English
Creator: Fenix, Alberto
Publisher: New College of Florida
Place of Publication: Sarasota, Fla.
Creation Date: 2011
Publication Date: 2011

Subjects

Subjects / Keywords: Cayos Cochinos
Honduras
Population Connectivity Maps
Acropora Palmata
Elkhorn Coral
DNA
Microsatellites
PCR
Genre: bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Population connectivity is an underlying concept in studies for conservation biology, marine organism biodiversity, population dynamics, marine preserve area (MPA) and fisheries management and design. Recently, the understanding of population connectivity has grown significantly, but the consensus is that more empirical data are needed to support theoretical studies and models currently in use. Gathering data for population connectivity is a monumental task because it spans through varying spatial and temporal scales requiring the collaboration of multiple disciplines of the physical sciences, even if the focus is just one marine organism. An iterative process approach has also been recommended wherein theoretical studies and current models give researchers insights in designing field experiments, which in return generate data that improve the models. Many data gathering efforts have focused on larval dispersal, which has been identified to be the main contributing process in population connectivity in the marine environment. A growing field in data gathering for larval dispersal is genetics, which has benefited from improved technologies that have lowered its costs of implementation and requires less material from the organism such that sample collection can be less invasive on the organism studied. In this study I gathered data on: (a) Acropora palmata (elkhorn coral), and (b) my field site. My field work was conducted over the summers of 2008 and 2009 at the Plantation Beach Resort Cove in Cayos Cochinos, Honduras and consisted of mapping out the nearest reef patches present, the locations of elkhorn coral colonies observed, and the collection of mucus samples of A. palmata. Current biogeographical designations and maps for the site were compiled in addition to new maps I created for the site. Mucus samples were processed at New College of Florida in the Spring of 2011, extracting the A. palmata DNA from several samples and putting them through multiplex PCR with primers designed to amplify Mendelian microsatellite markers of elkhorn coral. PCR products were visualized using agarose gel electrophoresis as a conservative (and quick) approach to identify genets and clonal ramets of the colonies sampled. The ultimate goal of this study was to begin gathering and consolidating data for population connectivity of the elkhorn coral in Cayos Cochinos, Honduras and to provide a stepping stone for further research in the area.
Statement of Responsibility: by Alberto Fenix
Thesis: Thesis (B.A.) -- New College of Florida, 2011
Electronic Access: RESTRICTED TO NCF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE
Bibliography: Includes bibliographical references.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The New College of Florida, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Local: Faculty Sponsor: Gilchrist, Sandra

Record Information

Source Institution: New College of Florida
Holding Location: New College of Florida
Rights Management: Applicable rights reserved.
Classification: local - S.T. 2011 F33
System ID: NCFE004374:00001

Permanent Link: http://ncf.sobek.ufl.edu/NCFE004374/00001

Material Information

Title: Population Connectivity of the Acropra Palmata on Cayos Cochinos, Honduras
Physical Description: Book
Language: English
Creator: Fenix, Alberto
Publisher: New College of Florida
Place of Publication: Sarasota, Fla.
Creation Date: 2011
Publication Date: 2011

Subjects

Subjects / Keywords: Cayos Cochinos
Honduras
Population Connectivity Maps
Acropora Palmata
Elkhorn Coral
DNA
Microsatellites
PCR
Genre: bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Population connectivity is an underlying concept in studies for conservation biology, marine organism biodiversity, population dynamics, marine preserve area (MPA) and fisheries management and design. Recently, the understanding of population connectivity has grown significantly, but the consensus is that more empirical data are needed to support theoretical studies and models currently in use. Gathering data for population connectivity is a monumental task because it spans through varying spatial and temporal scales requiring the collaboration of multiple disciplines of the physical sciences, even if the focus is just one marine organism. An iterative process approach has also been recommended wherein theoretical studies and current models give researchers insights in designing field experiments, which in return generate data that improve the models. Many data gathering efforts have focused on larval dispersal, which has been identified to be the main contributing process in population connectivity in the marine environment. A growing field in data gathering for larval dispersal is genetics, which has benefited from improved technologies that have lowered its costs of implementation and requires less material from the organism such that sample collection can be less invasive on the organism studied. In this study I gathered data on: (a) Acropora palmata (elkhorn coral), and (b) my field site. My field work was conducted over the summers of 2008 and 2009 at the Plantation Beach Resort Cove in Cayos Cochinos, Honduras and consisted of mapping out the nearest reef patches present, the locations of elkhorn coral colonies observed, and the collection of mucus samples of A. palmata. Current biogeographical designations and maps for the site were compiled in addition to new maps I created for the site. Mucus samples were processed at New College of Florida in the Spring of 2011, extracting the A. palmata DNA from several samples and putting them through multiplex PCR with primers designed to amplify Mendelian microsatellite markers of elkhorn coral. PCR products were visualized using agarose gel electrophoresis as a conservative (and quick) approach to identify genets and clonal ramets of the colonies sampled. The ultimate goal of this study was to begin gathering and consolidating data for population connectivity of the elkhorn coral in Cayos Cochinos, Honduras and to provide a stepping stone for further research in the area.
Statement of Responsibility: by Alberto Fenix
Thesis: Thesis (B.A.) -- New College of Florida, 2011
Electronic Access: RESTRICTED TO NCF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE
Bibliography: Includes bibliographical references.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The New College of Florida, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Local: Faculty Sponsor: Gilchrist, Sandra

Record Information

Source Institution: New College of Florida
Holding Location: New College of Florida
Rights Management: Applicable rights reserved.
Classification: local - S.T. 2011 F33
System ID: NCFE004374:00001


This item is only available as the following downloads:


Full Text

PAGE 1

! ! #$#%&'()$*!+$**,+()-)(.!$/! !"#$%$#!&%!'(!)! !$*!+'.$0!+$+1)*$02! 1$*3%4'0 05'&&!0(,#06!7'(1,4)*7!3 '(' ! 8.6 '&8,4($!(9!/,*):!))) '!(;<="= 0>?@"AAHGI!0J"IF"II@"H<@
PAGE 2

! "" !"#$%&'()*(+($,. /"EGEJ"GI!=>MMCHA!FCH!A;"=!A;<="=!KG=!MHCD"B?!CF!*@E"!'==CJ"GA"CE2!*EBGA"CE2!*GA>HGI!0J"HG=!#HCVEB2!GEB!3H9!0GEBHG!7"IJ;H"=A9!! )!KC>IB!I"UHGI!5GH"E@IB!I"UHG=!+CHGI!4<EB !GEB!A;HG=!FCH! MH<=HJ<9 )!KC>IB!I"UH"EL!@R!=AGR!GA!A;!AC!@R!FG@"IR!FCH!A;<"H!JCEF"B!AC!@R!JIG==@GA<=!GEB!FH"B!AC!A;B! AC!@R!A;<="=!JC@@"AA<HGL<@HG=!#HCVBGI!GJGB<@"J!GEB!MMMCHA!B>H"EL!@R!A"@
PAGE 3

! """ /01'(. %2.3%$,($,. ! ! !!!!!!!!!!!!!!!!! !M GL< &"=A!CF!/"L>H<= XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXD &"=A!CF!(G?I<= XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX99D""" 7IC==GHR!CF!(II!M"JA>HHH="CE XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXQP O9P9 (;?H HG= XXXXXXXXXXXXXXXXXXXXXXX9Q^ O9\9 +GRC=!+CJ;"EC= XXXXXXXXXXXXXXXXXXXXXXXXXXXXX99Q[ O9]9 #IGEAGA"CE!8IA"MIGI"WGA"CE XXXXXXXXXXXXXXXXXXXXXXXX9ZZ \9P9 4<=>IA= XXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXZZ \9Q!+CHGI!=G@MI"EL XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX999ZZ \9O!5"JHC=GA=="CE XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX9\P ]9Q! /"IA"MIIGA"CE!+CEE@?"B!E
PAGE 4

! "D /01'(.%2.3%$,($,!aJCEA"E>MMI<@H MC=FFHGI! 5GH"E@IGA"CE=!CF!A;HGI!5GH"E@
PAGE 5

! D 45-,.%2.65*78(! ! ! !!!! MGL< /"L>HLI=AHGA"CE!CF!A;IGA"CE! JCEEH=AHGA"CE!CF!FICK!DGH"G?"I"AR!G b!CF!A"BGI!GAEB!"=IGEB=!GEB!H<HA<=R!CF!hCEGA; GE! &G@?HH=AHGA"CE!CF!;CK!=C@HIGA"CE=!CF!B"=MLIH=AHGA"CE!CF!B"=MB"EL!IGHDGI!@CHAGI"AR!GEB!=>JJ<==F>I! H"A@HHEBGH"<=!C>AI"EAI"EHHH?H"EAGEG!4CC! k !+CW>@B"EL!+;@GI!8GR2!aZb!8IF!CF!1CEB>HG=2!a]b! *CHA;HG=!+CG=A!a"EJI>B"EL!A;JGAGE!+>HHIF!CF!1CEB>HG=!7RH<2!$FF=;CH
PAGE 6

! D" 45-,.%2.65*78(!aJCEA"E>H@?A>HHHGI!5CE>@HG=9!(GU@HGI!5GH"EC!aOPP[b9!a#IGEAGA"CE!8A!?R!?IGJU!GHHCKb XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXQd /"L>HHG=9!(GU@HGI!5GH"EC! aOPP[b9!!a#IGEAGA"CE!8 A!?R!?IGJU!GHHCKb XXXXOP /"L>H@HGI!5GH"EC!aOPP[b9! a#IGEAGA"CE!8A!?R!?IGJU!GHHCKb XXXXXXXXXXXXOQ /"L>H?G!B"D<@G=AH=AHGAA;CH XXXXXXXXXXXXXXXX99OZ /"L>HA;CHT=!"II>=AHGA"CE!CF!I@?HHG=!a'>A;CHT=!"II>=AHGA"CEb XX9O\ /"L>HEAG!+G oG!8GEG!aJCICE"<=!\P c \Obn!Z c !#>EAG!#H<=!AGU HGI"WGA"CE!>="EL!GLGHC=IA"MIIA"MIA!GI=C! =;CKHIGA"CE!>EB@MA"CE!A;GA!GMMHCS"@GAFF"J"?=A"A>AGI!=="EL!BGAG!FHC@!(G?I
PAGE 7

! D"" 45-,.%2.65*78(!aJCEA"E>H<2!LH<HMI<2!GEB!CHGELEH<=CID
PAGE 8

! D""" 45-,.%2./01'(. ! ! !!! !MGL< (G?I<=A"CE=!a(GU=U!JCII=IA"MI@?JA@=!IA"MI?<2!3*'!?<2!#84!=G@MI@?H"EL!JCII@<=! "E! p &!CF!M@!ZQ c \P2!IA=!FCH!@"JHC=GAIA"MI="DA!?GEB!ACC!A;"JU2!#84! k #IGEAGA"CE!8EA!CF!MHC?G?IJAHE"N>BIA"MI="D<9!a:! k !EC!G@MI"F"
PAGE 9

! "S 94:;;!<=.:6./>A"CE!CF!B"=M@?I<=!FHC@!A;IA!=C>HJH<= !A;HHHJIGH!GEB!MGHGIIGI=!A;GA!I"DIGA"CE=!K"A;!=C@HIGA"CE=!HGI=!AC! CA;IGA"CE=n!JIC=IGA"CE=!BC!ECA!GI=!AC!GE!GMMHGI=!G@CEL!L?MCM>IGA"CE=!A;GA!JC@MH"=IGA"CEn!=IGA"CE!JCEEJA"CE!AC!A;B"EL!;G?"AGA!J;C"JGI=!G@CEL!=>?MCM>IGA"CE=!A;G A!=>HD"DJ< ;('2.8("875,+($,@ !GI=C!JGII"A@IGA"CE!FHC@!"A=HJIGA"CE!"E!K;"J;!A;GI=!"=! LHGI=n!A;"A@IGA"CE!FHC@!G!ECEICJGI!MCM>IGA"CE!=C>HJ< a A(25$5,5%$-.,0#($.28%+.3%&($.0$).;B%$07*'(.FGHHIJ.&K%.+%)525().,K(+.28%+.,K(. 2%''%&5$*.-%78"(-@ !1GE=U"!GEB!0"@?!OPPP2!+CK
PAGE 10

! !"#$%&'$ ( #$%&'()*$+!,$++-,)*.*)/!*0!(+!&+1-2'/*+3!,$+,-%)!*+!0)&1*-0!4$2!,$+0-2.()*$+! 5*$'$3/6!7(2*+-!$23(+*07!5*$1*.-20*)/6!%$%&'()*$+!1/+(7*,06!7(2*+-!%2-0-2.-!(2-(! 89#:;!(+1!4*0<-2*-0!7(+(3-7 -+)!(+1!1-0*3+=!!>-,-+)'/ 6!)<-!&+1-20)(+1*+3!$4! %$%&'()*$+!,$++-,)*.*)/ !<(0!32$?+!0*3+*4*,(+)'/6!5& )!)<-!,$+0-+0&0!*0!)<() !7$2-! -7%*2*,('!1()( !(2-!+--1-1!)$!0&%%$2) !)<-$2-)*,('!0)&1*-0!(+1!7$1-'0!,&22-+)'/!*+! &0-=!@()<-2*+3!1()(!4$2!%$%&'()*$+!,$++-,)*.*)/!*0!(!7$+&7-+)('!)(0A !5-,(&0-!*)! 0%(+0!)<2$&3-0$2)!K$.-! *+!K(/$0!K$,<*+ $06!L$+1&2(0!(+1!,$+0*0)-1!$4!7(%%*+3!$&)!)<-!+-(2-0)!2--4!%(),<-0! %2-0-+)6!)<-!'$,()*$+0!$4!-'A<$2+!,$2('!,$'$+*-0!$50-2.-16!(+1!)<-!,$''-,)*$+!$4! 7&,&0!0(7%'-0!$4! !+'%&()&*& =!!K&22-+)!5*$3-$32(%<*,('!1-0*3+()*$+0!(+1!7(%0!4$2!

PAGE 11

! "# $%&!'#$&! (&)&!*+,-#.&/!#0!1/ /#$#+0!$+!0&( !,1-'!2!*)&1$&/!3+)!$%&!'#$&4! !56*6'! '1,-.&'!(&)&!-)+*&''&/!1$ !7&(!8+..&9&!+3!:.+)#/1!#0!$%&!;-)#09!+3!<=>>?!&"$)1*$#09 $%& !"#$%&'%(% !@7A 3)+,!'&B&)1.!'1,-.&'! 10/!-6$$#09!$%&,!$%)+69%!, 6.$#-.&"!C8D! (#$% !-)#,&)'!/&'#90&/!$+!1,-. #3E!5 &0/&.#10!, #*)+'1$&..#$& !,1)F&)'!+3!&.F%+)0!*+)1.4!! C8D!-)+/6*$'!(&)&!B#'61.#G&/!6'#09!191)+'&!9&.!&.&*$)+-%+)&'#'!1'!1!*+0'&)B1$#B&! H10/!I6#*FJ!1--)+1*%!$+!#/&0$#3E!9&0&$'!10/!*.+01.!)1,&$'!+3!$%&!*+.+0#&'!'1,-.&/4!! K%&!6.$#,1$&!9+1.!+3!$%#'!'$6/E!(1'!$+!L&9#0!91$%& )#09!10/!*+0'+.#/1$#09!/1$1!3+)! -+-6.1$#+0!*+00&*$#B#$E!+3!$%&!&.F%+)0!*+)1.!#0!81E+'! 8+*%#0+'?!M+0/6)1'!10/!$+ -)+B#/&!1!'$&--#09!'$+0&!3+)!36)$%&)!)&'&1)*%!#0!$%&!1)&14!! NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN A--)+B&/!LE!@)4!;10/)1!O#.*%)#'$? !P#+.+9E

PAGE 12

! !"#" $%&&'$()*)(+ #$%&'()*$+!,$++-,)*.*)/!$0!1(2*+-!$23(+*414!5(4!6--+!)5-!,$+,-%)&('! ,$+)-7)!0$2!,$+4-2.()*$+!(+8!6*$8*.-24*)/!*+!1(2*+-!-,$'$3/!9:$;-+!(+8!<%$+(&3'-! =>>?@!4--!2-.*-;!$0!:$;-+!-)!('A!=>>B@!C$+-4!-)!('A!=>>BD@!0*45-2*-4@!(+8!1(2*+-! %2-4-2.-!(2-(!9E#FD!1(+(31-+)@!8-4*3+!-00$2)4!(+8!4)&8*-4!9G-/1(+!-)!('A!=>>H@! <('-!(+8!I2*)J-2!=>>H@!4--!2-.*-; !$0!K$3(2)/!-)!('A!=>>BDA!!L 5-$2-)*,('!4)&8*-4! 4&33-4)!)5()!%$%&'()*$+!,$++-,)*.*)/!*4!(!1(M$2!0(,)$2!*+!'$,('!(+8!1-)(%$%&'()*$+! 8/+(1*,4@!,$11&+*)/!8/+(1*,4!(+8!4)2&,) &2-@!3-+-)*,!8*.-24*)/@!(+8!2-4*'*-+,/!$0! %$%&'()*$+4!)$!(+)52$%$3-+*,!)52-()4!9N$)40$28!-)!('A!=>>"@!G(4)*+ 34!(+8!G(22*4$+! "??O@!:$;-+!-)!('A!=>>B @!:$;-+!-)!('A!=>>=DA!!:$;-+!(+8!<%$+(&3'-!9=>>?D!%$*+)!$&)! )5()!P4&,,-440&'!8*4%-24('@!-4%-,*(''/!(1$+3!4&6% $%&'()*$+4Q!*4!$+-!$0!)5-!*1%$2)(+)! 0(,)$24!*+!%$%&'()*$+!,$++-,)*.*)/A!! R-%-+8*+3!$+ !4%-,*-4@!1(2*+-!$23(+*414!5(.-!$%%$2)&+*)/!)$!8*4%-24-!()! 8*00-2-+)!'*0-!4)(3-4!02$1!4%$2-@!-33@!$2!'(2.(!)$!M&.-+*'-!(+8!(8&')A!!L5-!1(*+!0$,&4!*+! %$%&'()*$+!,$++-,)*. *)/!4)&8*-4@!*+!3-+-2('@!*4!8*4%-24('!()!)5-!'(2.('!4)(3-!-4%-,*(''/! 0$2!6-+)5*,!9'*))$2('!$2!4-44*'-D!1(2*+-!$23(+ *414!9:$;-+!(+8!<%$+(&3'-!=>>? @! N$)40$28!-)!('A!=>>"DA!!N&)!8-4%*)-!)5-!2-,$3+*)*$+!$0!)5-!*1%$2)(+,-!$0!'(2.('! 8*4%-24('!*+!,$++-,)*.*)/!)5!,$+4-+4&4!*4!)5()!)5-2-!4)*''!'(,S4!4&64)(+)*('!-1%*2*,('! 8()(!9:$;-+!(+8!<%$+(&3'-!=>>?@!G-/1(+!-)!('A!=>>H@!<('-!(+8!I2*)J-2!=>>H D A !"!", (-.,/0123.4567,08,6-.,8933,25/69:.,08,3;:<;3,=5>2.:>;3 L5-!(6*'*)/!)$!$6)(*+!8*2-,)!$64-2.()*$+('!8()(!$0!'(2.('!8 *4%-24('!;(4!(+8!4)*''! *4!'*1*)-8! 6-,(&4-!$0 !)5-!41(''!4*J-!$0!'(2.(-!9G-/1(+!-)!('A!=>>H@!T(*+-4!-)!('A!=>>BDA!! U+!)5-!%(4)@!2-4-(2,5-24!)$$S!S+$;+!(+8!-4)*1()-8!%-'(3*,!'(2.('!8&2()*$+4!9#VR4D@!

PAGE 13

! #$%&'&%!%()*&+),'!%()-+(./-($0)!$1!*,))(2&!*,+-(3'&!-+,4&3-$ +(&)!(0!$3&,0(3!3/++&0-)5! ,0%!6&0&-(3!2,+(,-($0)!$1!,''&'&!1+&7/&03(&)!$1!#(-$38$0%+(,'!$+!0/3'&,+!9:;!-$! &)-(#,-&!*+$.,.'&!%()*&+),'!+,06&)!<=$80)$0!>?@A5!B38&' -&#,!>?CC5!D',0&)!"AA"5! E$F&0!&-!,'G!"AAH IG!!J8&)&!&)-(#,-&)!)/66&)-&%!'$06 K +,06&!%()*&+),')!$+ !,! %&#$6+,*8(3,''L!$*&0!)L)-&#!F8&+&!'$3,'!*$*/',-($0)!,+&!<$+!3,0!.&I!)&--'&%!.L! ',+2,&!1+$#!)$/+3&)!$2&+!8/0%+&%)!-$!-8$/),0%)!$1!M('$#&-&+)!,0%!F&+&!)/**$+-&%! .L!)$#&!)-/%(&)!-8,-!)8$F&%!6&0&-(3!8$#$6&0&(-L!(0!)$#&!)*&3(&)N!)-+/3-/+&)!<)&&! +&2(&F)O!E$F& 0!,0%!B*$0,/6'&!"AA?5!E$F&0!&-!,'G!"AAH5!P,F,+M&F(3Q!&-!,'G!"AAH5! E$F&0!&-!,'G!"AAAIG!! R/-!#$+&!+&3 &0-!)-/%(&)!,+&!)8$F(06 !-8,-!-8()!#,L!0$-!.&!-8&!3,)&!1$+!#,0L! #,+(0&!$+6,0()#)!,0%!#$+&!+&)&,+38 &+) !,+&!'$$M(06!,-!-8&! #&)$5!(0-&+#&%(,-&5!,0%! 1(0&+!)3,'& )!$1!',+2,'!%()*&+),'!(0!*$*/',-($ 0!3$00&3-(2(-LG!! E$F&0!,0%!B*$0,/6'&! <"AA?I!(%&0-(1L!%(11&+&0-!(0-&+,3-(06!*+$3&))&)!%+(2(06!',+2,'!%()*&+),'!,0%! *$*/',-($0!3$00&3-(2(-L!,)!F8L!-8&+&!()!-8() !)8(1-!(0!+&3$60(Q(06!-8,-!-8&!)*,-(,'! )3,'&)!#,L!.&!#/38!)#,''& +5!-8,-!)L)-&#)!#,L!.&!#$+&!3'$)&%5!,0%!-8&!+&*&-(-(2&! #&0-($0!$ 1!',3M!$1!)/.)-,0-(,'!&#*(+(3,'!I G! D$*/',-($0!3$00&3-(2(-L!)-/%(&)!,+&!(08&+&0-'L!,!.($ K *8L)(3,'!*+$.'&#O!-8&! *8L)(3,'!3$#*$0&0-!3$#*+()(06!$1!-8&!*8L)(3,'!$3&,0$6+,*8L5!)&,!-&#*&+, -/+&)5! ),'(0(-L5!3'(#,3-(3!&2&0-)!-$!)&--'&#&0-!8,.(-,-!,0%!-8&!.($'$6L!3$#*$0&0-!$1!',+2,'! 3,*,.('(-(&)!,0%!.&8,2($+!$1!-8&!#,+(0&!$+6,0()#T)G!!R$-8!3$#*$0&0-)!.L! -8&#)&'2&)!,+&!,'+&,%L!3$#*'&U!F(-8!#,0L!2,+(,.'&)!-$!3$0)(%&+!,0%!1(0%(06!-8&! *,--&+0)!,0%! -+&0%)!,))$3(,-&%!F(-8!-8&!(0-&+,3-($0!$1!.$-8!()!,!#$0/#&0-,'!-,)M5! )/38!-8,-!-8&+&!8,)!.&&0!0$!3$#*+&8&0)(2&!)-/%L!$1!-8&!1/''!)L)-&#!1$+!,0L!#,+(0&!

PAGE 14

! #$%&'()*!+,#-.'!./!&0 1!23345!6&-&$7.-(89!./!&01!2334:5!&';!/<.$.!()!&!'..;!=#$! 8#00&>#$&/(#'!>./-..'!;()8 (?0('.)!#=!?<@)(8&0!#8.&'(8!?$#8.)).)!&';!>(#0#%@! + A.$'.$!./!&01!2334 : 1!! ! !"#$%&'() !,#-.'!&';!B?#'&C%0.D)!+233E:!(00C)/$&/(#'!#=!/<.!8#*?0.F(/@! #=!/<.!('/.$&8/(#')!#=! ?$#8.)).)!('<.$.'/!(' !0&$G&0!;()?.$)&0!&';!?#?C0&/(#'!8#''.8/(G(/@ !('!&!)?&/(&0!8#'/ .F/ 1! (*+*' ,-%.-/'0"12&%1-/'3'4$%%&561 H#$.!-#$7!()!>.('%!;#'.!('!'.&$)<#$.!<@;$#;@'&*(8)!>.8&C).!/<.!)/&$/('%! &';!.';('%!?#('/)!#=!0&$G&0!;()?.$)&0!&$.!'.&$)<#$.!=#$!8#&)/&0!*&$('.!#$%&'()*)! &';!>.8&C).!/<.#$./(8&0!)/C;(.)!&$.!)<#-('%!/<&/!/<.).!?<@)(8 &0!*.8<&'()*)! ANRV396-MA01-18ARI4November20088:39 variabilityandallowingconstructionofaconnectivitymatrix( Figure1 ).Modelsarealsopowerful toolswhencombinedwitheld/empiricalmethods(Werneretal.2007).Besidestheirutilityin resolvingspatialscalingpatterns,modelsarealsocriticallyimportantinresolutionoftheprocesses contributingtothepatterns,andthusarediscussedingreaterdetailbelow. EXPLANATION:PROCESSESTHATDRIVELARVALDISPERSAL ANDPOPULATIONCONNECTIVITY Highspatialandtemporalvariabilityintheabundanceofearlylifehistorystagesthroughsettlementandrecruitmentimpliesacomplexsetofinteractingprocessesthatoperateacrossvarious scalestoestablishtheseeminglystochasticpatternsobserved( Figure2 ).Fundamentally,weneed tounderstandtheprocessesthatdrivedispersalpatternsbeforewecanfullydescribepatterns ofpopulationconnectivity.Indoingso,thelinkfromlarvaldispersaltopopulationconnectivity isobviousbecausetheprocessesthatcontrolthedispersalofindividualsfromonelocationto anotherdemographicallyconnectmanybenthicmarinepopulations.However,theinuenceof Contributing processes Connectivity Spatial co ntext (abundance) Spawing output Larval dispersal (currents) Larval dispersal + behavior Pred./prey mediated survival Available settlement habitat Post-sett. survival (larval condition) Figure2 Arepresentationofthecombinedprocessesthatacttodeterminethespatialconnectionsamongpopulations vialarvaldispersalandsurvival.Thespatialcontextisdepictedbyaseriesofpopulations(eachrepresented byasinglebandontheleft).Thespawningoutputofthosepopulationsisdependentonthesize,fecundity, etc.ofeachpopulation;hencetherelativesizeofeachbandindicatesspatialvariabilityinreproductive output.Thelarvalphysicaldispersalprocess(advectionanddiffusion)actstomixtheyoung( thecrossinglines todifferentbars ),expandthespatialdistributionofthelarvae( expandedsizeofthebands ),andconsequently dilutetheconcentration( lightercolor ).Withtheinclusionoflarvalbehaviors(e.g.,verticalmigration, horizontalswimming),thediffusivenatureofthephysicalprocessesmaybecounteractedthrough biophysicalinteractions;hencetheconstrictionofthespatialextentandincreaseindensity( smallerbandsand darkercolor ).Inadditiontophysicaldispersal,variousbiologicalandphysicalfactorsoperatetoextracta spatiallyvaryingloss(mortality)asdepictedbyacontinualreductioninavailablesurvivors( smallerbands )due topredator/preyinteractions,availabilityofsettlementhabitat,andpostsettlementsurvivorship,inpart drivenbylarvalconditionattimeofsettlement(e.g.,carryovereffects).Comparisonofthetwoextremesof thisgure(thesourceandreceivinglocations)providesanideaofthepatternofconnectivity,orthescaleof successfuldispersal.Thestepsbetweenthesetwoendsprovideanoverviewoftheprocessesthatcontribute tothedispersalkernel. 450Cowen Sponaugle Annu. Rev. Marine. Sci. 2009.1:443-466. Downloaded from arjournals.annualreviews.org by University of California Santa Barbara on 01/05/09. For personal use only. ANRV396-MA01-18ARI4November20088:39 variabilityandallowingconstructionofaconnectivitymatrix( Figure1 ).Modelsarealsopowerful toolswhencombinedwitheld/empiricalmethods(Werneretal.2007).Besidestheirutilityin resolvingspatialscalingpatterns,modelsarealsocriticallyimportantinresolutionoftheprocesses contributingtothepatterns,andthusarediscussedingreaterdetailbelow. EXPLANATION:PROCESSESTHATDRIVELARVALDISPERSAL ANDPOPULATIONCONNECTIVITY Highspatialandtemporalvariabilityintheabundanceofearlylifehistorystagesthroughsettlementandrecruitmentimpliesacomplexsetofinteractingprocessesthatoperateacrossvarious scalestoestablishtheseeminglystochasticpatternsobserved( Figure2 ).Fundamentally,weneed tounderstandtheprocessesthatdrivedispersalpatternsbeforewecanfullydescribepatterns ofpopulationconnectivity.Indoingso,thelinkfromlarvaldispersaltopopulationconnectivity isobviousbecausetheprocessesthatcontrolthedispersalofindividualsfromonelocationto anotherdemographicallyconnectmanybenthicmarinepopulations.However,theinuenceof C o n t r i b u t i n g p r o c e s s e s Connectivity S p a t i a l c o n t e x t ( a b u n d a n c e ) Spawing output Larval dispersal (currents) Larval dispersal + behavior Pred./prey mediated survival Available settlement habitat Post-sett. survival (larval condition) Figure2 Arepresentationofthecombinedprocessesthatacttodeterminethespatialconnectionsamongpopulations vialarvaldispersalandsurvival.Thespatialcontextisdepictedbyaseriesofpopulations(eachrepresented byasinglebandontheleft).Thespawningoutputofthosepopulationsisdependentonthesize,fecundity, etc.ofeachpopulation;hencetherelativesizeofeachbandindicatesspatialvariabilityinreproductive output.Thelarvalphysicaldispersalprocess(advectionanddiffusion)actstomixtheyoung( thecrossinglines todifferentbars ),expandthespatialdistributionofthelarvae( expandedsizeofthebands ),andconsequently dilutetheconcentration( lightercolor ).Withtheinclusionoflarvalbehaviors(e.g.,verticalmigration, horizontalswimming),thediffusivenatureofthephysicalprocessesmaybecounteractedthrough biophysicalinteractions;hencetheconstrictionofthespatialextentandincreaseindensity( smallerbandsand darkercolor ).Inadditiontophysicaldispersal,variousbiologicalandphysicalfactorsoperatetoextracta spatiallyvaryingloss(mortality)asdepictedbyacontinualreductioninavailablesurvivors( smallerbands )due topredator/preyinteractions,availabilityofsettlementhabitat,andpostsettlementsurvivorship,inpart drivenbylarvalconditionattimeofsettlement(e.g.,carryovereffects).Comparisonofthetwoextremesof thisgure(thesourceandreceivinglocations)providesanideaofthepatternofconnectivity,orthescaleof successfuldispersal.Thestepsbetweenthesetwoendsprovideanoverviewoftheprocessesthatcontribute tothedispersalkernel. 450Cowen Sponaugle Annu. Rev. Marine. Sci. 2009.1:443-466. Downloaded from arjournals.annualreviews.org by University of California Santa Barbara on 01/05/09. For personal use only.

PAGE 15

! #$%&'()*&+!,%-!#,%!+./0,(%!&1+!+2(-+%#+!$3!1(41+'!0 $#,0!'+&+%&($%!&1,% !)+0(+2+! /'+2($*506 !78$9+%!,%-!:/$%,*40+!;<<=>!8$9+%!+&!,0?!;<<@>!A,9,'B+9(#C!+&!,0?!;<<@>! D(%+-,!+&!,0? !;<<@E?!!F1+!,55*G/&($%5!+,'0(+' !9+'+!&1,&!0,'2,+!9+'+!5+%&!$*&!$3351$'+! )6!#*''+%&5>!3$'G+-!,!9+00 H G(.+-!5$*'#+!/$$0!,%-!',%-$G06!'+/0+%(51+-!0$#,0! /$/*0,&($%5?!!I*&!G$'+!'+5+,'#1+'5 !,'+!3(%-(%4!&1,&!0+2+05!$3!5+03 H '+#'*(&G+%&!,'+! G*#1!1(41+'!&1,%!9,5!+./+#&+-!3$'!'++3!3(51!7J0G,%6!+&!, 0?!;<<@>!K$%+5!+&!,0?!;<!F+G)6!+&!,0?!;<<@E?!!N &!(5!,//,'+%&!&1,&!%+,'51$'+!/165(#,0!/'$#+55+5!,'+! (G/$'&,%&!&$!0,'2,0! -(5&'()*&($%!7D(%+-,!O===>!O==" E>!)*&!&1+'+! ,'+!5$!G,%6!/165(#,0! /'$#+55+5!&1,&!-'(2+!%+,'51$'+!30$95!&1,&!%++-!&$!)+! ,55+55+?!!P1(0+!$3351$'+M-++/! $#+,%!&(-,0!+00(/5+5!&+%-!&$!)+!(5$G$'/1(#!78$9+%!+&!,0?!;<<@E>!2,'(,)(0(&6!$##*'5!,5! 6$*!G$2+!&$9,'-5!&1+!51$'+!3'$G!&1+!),&16G+&'6!$3!&1+!#$%&(%+%&,0 !51+03>!51,00$9+'! -+/&15>!,%-!&1+!51$'+0(%+!),''(+'!&1,&!#,%!#'+,&+!,0$%4 H 51$'+!#*''+%&5!7D(%+-,!+&!,0?! ;<<@>!5++!Q(4*'+!;E?!!J--(%4!&$!&1+!#$G/0+.(&6!,'+!&1+!5*'3C$%+>!5*'3,#+!,%-!(%&+'%,0! &(-+5>!9(%H 3$'#(%4>!(%&+'%,0!9,2+5!,%-!)$'+5>!9,&+'!#$0*G%!5&',&( 3(#,&($%5!-*+!&$! 3'+519,&+'!'*% H $335>!&+G/+',&*'+>!,%-!5,0(%(&6>!91(#1!,00!#,%!)+!2,'(,)0+!$%!&1+! &+G/$',0!5#,0+!3'$G!+2+%& H 5#,0+5!$3!1*''(#,%+5! ,%-!5&$'G5!&$!0$%4+'!/+'($-(#! +2+%&5! 7+?4?!R0!S(%$E!7A,9,'B+9(#C !+&!,0?!;<<@ >!P+'%+'!+&!,0?!;<<@ !F,/(,!+&!,0?!; <<">!D(%+-,! O=== E!7T$9!5$G+!$3!&1+5+!/'$#+55+5!,33+#&!0 ,'2,0!&',%5/$'&!5++!Q(4*'+!UE?! F1+5+!/'$#+55+5!,33+#&!0,'2,0!&',%5/$'&!7&'+,&(%4!0,'2,+!,5!,!/,55(2+!/,'&(#0+E>! )*&!0,'2,0!)+1,2($'!%++-5!&$!)+!,##$*%&+-!3$'!,5!9+00!&$!+5&(G,&+!0,'2,0!-(5/+'5,0?!!!N&! (5!9+00!B%$9%>!-+/+%-(%4!$%!&1+!&,.,>!&1,&!0,'2,+!#,%!G(4',&+!2+'&(#,006!,%-!1,2+! 1$'( C$%&,0 06 !$'(+%&+-!59(GG(%4!#,/,)(0(&(+5?!!:$G+!5&*-(+5!,'+!51$9(%4!&1,&!

PAGE 16

! #$ %$ "#$%&'!() !&''()*+#*,-.!-/!/'-0!1#+,#%,',*2!#$!-/!*,3#'!4'',5 ) 4)!#55+-#67,.8!*74!)7-+4 !-/!9-.*4+4 2!:#2! ;<#=4.!/+->!?#1#'!@-)*8+#3(#*4!A67--' !B&.*4+.4*CD!B6,*43!EFGGC $ !#.3!%$! )#>5'4!14'-6,*2!/,4'3)!#+-(.3! ,)'#.3)!#.3!+44/)!/+->!*74!H+4#*!:#++,4+!I44/!;<#=4.!/+->!J4+.4+!4*!#'K!EFFLD!6-(+*4)2!-/!M-.#*7#.! N#>%+467*)!#.3!O+,6!P4''4+).,Q34+$ K Oceanography September 2007 61 terms of the physics and biology needed to capture the underlying dynamics. Physical and biological processes occur at multiple scales and they generally overlap and interact. For instance, many source regions are located in the near shore environment, where there remain fundamental issues in resolving near shore (e.g., wave-dominated) physics and its coupling to inner shelf dynam ics. In turn, inner-shelf circulation can be affected by processes occurring along the outer edge of the continental shelf, where shelf and oceanic dynamics inter act and are often inuenced by strong boundary currents in the presence of increased levels of mixing and internal wave elds. At the same time, a criti cal aspect of the modeling necessary for understanding population connectiv ity is the incorporation of behavior and other biological processes into models. In the following sections, we briey dis cuss elements of our modeling capabili ties that need to be improved. Physics and H ydrodynamics Advances are needed to better represent models' internal physical dynamics, par ticularly at intermediate/submesoscale to small scales, such as frontal dynamics (Gawarkiewicz et al., this issue), waveinduced and boundary-layer processes (Monismith, 2007), and other nonhy drostatic ows (e.g., Scotti and Pineda, 2007). For example, aperiodic, submesoscale eddies that develop along the interface between the Florida Current and the steep Florida shelf edge have been shown to signicantly inuence (positively and negatively) the delivery of certain coral reef sh larvae to settlement habitat along the reef track (Sponaugle Figure 5. ( A ) Sample velocity elds in the vicinity of reefs and islands in the G reat Barrier R eef ( courtesy of Jonathan Lambrechts and Eric Deleersnijder ). (B) Coral colony ( from Monismith, 2007, reprinted with permission from the A nnual R eview of Fluid Mechanics Volume 39 2007 by Annual Reviews, www.annualreviews.org ) (C) L aboratory measurements of the streamwise (arrows) and vertical ow (color) within the colony measured by magnetic resonance imagery, yet to be modeled and merged within larger-scale domains ( image from Chang, 2007; courtesy of Sandy Chang ). A C B et al., 2005; D'Alessandro et al., 2007). Additional modeling efforts are to realis tically capture these eddies' features (e.g., Fiechter and Mooers, 2003). There is also a need for better speci cation of external forcing surface uxes (which continues to challenge all circula tion models), especially at event scales.

PAGE 17

! #$%&'(%)*!)+!#$,,'('-+!#'&+.%!$%!/0('!10/&)1+!+.)-!&)%%$2'!&)(+$1*' !+()3'1+0($'%!0-! +.'!%4 (,)1'!5 607'-!'+!)*8!9::;$?4('!@=8!A*%0$?4('!G=8! !"#$%&'() !H**4%+()+$0-!0,!.07! %0/'! -')(%.0('!,*07!#B-)/$1%! 1)-!),,'1+!*)(2)*!+()-%&0(+!5I)J'-!,(0/! C$-'#)!'+!)*8!9::;=8 K0#'*$-?!,0(!'%+$/)+$-?!&(0L)L$*$+$'%!0,!#$%&'(%)*!)('!-07!)1104-+$-?!,0(! +.'%'!,*4$#!#B-)/$1%!)-#!*)(2)*!L'.)2$0(!)-#!/0(+)*$+B
PAGE 18

! !"#$%&'() !#$%&'!()*+',-)$.(!$/!%)(0&1(,'!0,--&1.(!2$*0,1).3!4&1-)2,'!*)31,-)$.!,.%!5$1)6$.-,'! (7)**).3!(2&.,1)$(!-$!0,(()4&!0,1-)2'&!%)(0&1(,'!8-,9&.!/1$*!:$7&.!,.%!;0$.,+3'&!<==>?@ 5,A)-,-!1&2$3.)-)$.!8 B,7,19&7)26!&-!,'@!<=="C!D$.&(!&-!,'@!<=="C!E$3,1-F!&-!,'@!<=="C! G).&%,!&-!,'@!<=="C!B,).&(!&-!,'@!<=="?@!!H&(&,125&1(!1&2$3.)6&!-5,-!+.%&1(-,.%).3! 0$0+',-)$.!2$..&2-)4)-F!.&&%(!,.!).-&1%)(2)0').,1F!,001$,25!,.%!)(!,.!)-&1,-)4&! ANRV396-MA01-18ARI4November20088:39 Passive A + V + H 0 2 5 m m s 1 0 2 5 m m s 1 0 2 5 m m s 1 1 0 m m s 1 1 0 m m s 1 1 0 m m s 1 5 0 m m s 1 5 0 m m s 1 5 0 m m s 1 DVMAbove haloclineBottom-oriented Figure4 Exampleoftheinuenceofverticalswimmingbehaviorondispersaloutcomesascomparedwithpassive (non-swimming)scenariosforminimalswimmers(e.g.,dinoagellates)tomoderateswimmers(e.g.,sh larvae)atthemouthoftheChesapeakeBay.Inthemodelsimulations,fourbehavioralscenariosare compared:passive,dielverticalmigration(DVM),surface-oriented(salinitygradientcueing;stayingabove thehalocline),andbottom-orientedswimming.Inthethreeswimmingscenarios,threeverticalswimming speedswerecompared(0.25mms 1 ,1.0mms 1 ,and5mms 1 ).Allscenarioshaveadvective(A)model outputcoupledwithbothhorizontal(H)andvertical(V)turbulencecomponentsusingrandomwalkand randomdisplacementmodels,respectively.2500particleswerereleasedineachscenariowithin1m 3 at 0.51.5mdepth,andthentrackedforsevendays.Notethatmanynonpassivescenariosresultedinagreater proportionofparticlesretainedwithinthebaymouththanforthepassivescenario.Further,althougheven minimalswimmingspeedsenhancedretention,thefastestspeeds(5mms 1 )resultedinthemostretention. FromE.W.North,Z.Schlag,M.Li&L.Zhong,unpublishedresults. Withtheexpandedavailabilityofenvironmentaldatathroughoceanobservationnetworks,the needforproperdesignofelddeploymentscanalsobenetfrommodelscenariosanddataassimilation(Walstad&McGillicuddy2000).Observationsystemsimulationexperiments(OSSEs) maybeofusefordesigningstudiesofpopulationconnectivityandexpandingthetimeandspatial domainoverwhichempiricalmeasurementsareregularlyavailable(Werneretal.2007). 456Cowen Sponaugle Annu. Rev. Marine. Sci. 2009.1:443-466. Downloaded from arjournals.annualreviews.org by University of California Santa Barbara on 01/05/09. For personal use only. ANRV396-MA01-18ARI4November20088:39 Passive A + V + H 0.25 mm s 1 0.25 mm s 1 0.25 mm s 1 1.0 mm s 1 1.0 mm s 1 1.0 mm s 1 5.0 mm s 1 5.0 mm s 1 5.0 mm s 1 DVMAbove haloclineBottom-oriented Figure4 Exampleoftheinuenceofverticalswimmingbehaviorondispersaloutcomesascomparedwithpassive (non-swimming)scenariosforminimalswimmers(e.g.,dinoagellates)tomoderateswimmers(e.g.,sh larvae)atthemouthoftheChesapeakeBay.Inthemodelsimulations,fourbehavioralscenariosare compared:passive,dielverticalmigration(DVM),surface-oriented(salinitygradientcueing;stayingabove thehalocline),andbottom-orientedswimming.Inthethreeswimmingscenarios,threeverticalswimming speedswerecompared(0.25mms 1 ,1.0mms 1 ,and5mms 1 ).Allscenarioshaveadvective(A)model outputcoupledwithbothhorizontal(H)andvertical(V)turbulencecomponentsusingrandomwalkand randomdisplacementmodels,respectively.2500particleswerereleasedineachscenariowithin1m 3 at 0.51.5mdepth,andthentrackedforsevendays.Notethatmanynonpassivescenariosresultedinagreater proportionofparticlesretainedwithinthebaymouththanforthepassivescenario.Further,althougheven minimalswimmingspeedsenhancedretention,thefastestspeeds(5mms 1 )resultedinthemostretention. FromE.W.North,Z.Schlag,M.Li&L.Zhong,unpublishedresults. Withtheexpandedavailabilityofenvironmentaldatathroughoceanobservationnetworks,the needforproperdesignofelddeploymentscanalsobenetfrommodelscenariosanddataassimilation(Walstad&McGillicuddy2000).Observationsystemsimulationexperiments(OSSEs) maybeofusefordesigningstudiesofpopulationconnectivityandexpandingthetimeandspatial domainoverwhichempiricalmeasurementsareregularlyavailable(Werneretal.2007). 456Cowen Sponaugle Annu. Rev. Marine. Sci. 2009.1:443-466. Downloaded from arjournals.annualreviews.org by University of California Santa Barbara on 01/05/09. For personal use only.

PAGE 19

! #$%&'((!)'*+'',!-%.'/0,1!*%! 2'/#!130.'!4,.!&%,(*$3&*!50'/.!(*3.0'(6!+20&2!0,!$'*3$,! 107'!'-#0$0&4/!.4*4!*%!0-#$%7'!*2'!-%.'/(!8 9'$,'$!'*!4/:!;<<= 6!>%+',!'*!4/:!;<<=?:! !"#$%&'() !@//3(*$4*0%,!%5!.0(#'$(4/!'(*0-4*'(!0,&/3.0,1!/4$74/!-%$*4/0*A!4,.!(3&&'((53/!$'&$30*-',*!4(! 74$04)/'(!8 B4C',!5$%-!9'$,'$!'*!4/:!;<<=?: *+,+' -%./0"1#'2.%3.& D92'$'!.%!*2'!/4$74'!5$%-!4!(%3$&'!4&*34//A!1%EF!%$!5$%-!4!.055'$',*! #'$(#'&*07'6!D92'$'!.0.!*2'!0,.070.34/(!0,!*2'!/%&4/!#%#3/4*0%,!&%-'!5$%-EF!4$'! Oceanography September 2007 57 the true probability of successful down stream transport because larval concen trations are reduced by several orders of magnitude by along-trajectory diffu sion and mortality of larvae (Figure 2B). Within 30 days, model larvae released from a 1-km 2 location near Barbados spread over 10 6 km 2 representing a reduction of the original concentration of larvae by six orders of magnitude (Figure 2A). If mortality is included, there are not enough larvae occurring within any coastal region to sustain downstream populations from a source population, even when all larvae pro duced at the source leave the source area. Shelf Scales Over the last two decades, the advent and establishment of sophisticated and realistic coastal circulation models (e.g., Haidvogel and Beckmann, 1999), including unstructured and nested grids (Lynch et al., 1996; Greenberg et al., 2007), nonhydrostatic models (Fringer et al., 2006; Scotti and Pineda, 2007), and large-eddy simulations (LES; Lewis, 2005), have enabled the quan titative study of key physical processes in varying degrees of approximation. Similar to the developments in basinscale modeling, public-domain "com munity" models, such as the Regional Ocean Model System (ROMS) and the Princeton Ocean Model (POM), render well-established approaches/protocols to be considered and tailored (with relative ease) to site-specic applications with known attributes and limitations. Useful data-assimilation and nowcast/forecast systems are presently being developed and applied with some having reached quasi-operational status, allowing for sustained analyses of certain processes in limited area domains (see Robinson and Lermusiaux, 2002). Taking advantage of the wide range of robust and advanced circulation models, spatially explicit IBMs have been used to determine trajectories, or Lagrangian pathways, of planktonic stages of marine organisms in realistic (i.e., spatially het erogeneous and time-dependent) ow elds. IBMs keep track of individuals within a population, and have become a de facto modeling approach in efforts to study the interactions of marine organ isms with their environments and to understand factors impacting dispersal and population connectivity (Werner et al., 2001a). The simplest of these stud ies ignores biotic factors such as feeding and predation, but includes imposed 75 70 65 60 55 10 15 20 Longitude Latitude A 75 70 65 60 55 10 15 20 Longitude Latitude B Figure 2. Simulation of the role of dispersal and natural larval mortality on the prob ability of successful recruitment. ( A ) Model results of a 30-day dispersal period initiated at the island of Barbados (*). L arvae are spread over a 10 6 km 2 area result ing in a six-order-of-magnitude dilution of the initial concentration of larvae (i.e., 10,000 larvae km 2 ). (B) Same simulation with the added e ect of natural mortality during the 30-day larval phase (18% d -1 ). Mortality further reduces the concentration of larvae by another three orders of magnitude. A bout 10% of these larvae (blue dots) nd suitable habitat. Modied from Cowen et al. (2000) with permission from the American Association for the Advancement of Science.

PAGE 20

! #$%&'()*&!'+,'!-,*.!+,/%!&)$0+'!,*1!,2%!&%%3(*0!')!,*&4%2!')!(-52)/%!%6(&'(*0! -)1%7&8!!9%4!-%'+)1&!):!'2,;3 (*0!,2%!<%(*0!1%/%7)5%1!,*1!'%&'%1!')!+%75!,*&4%2! '+(&!#$%&'()*!:2)-!0%);+%-(;,7!&(0*,'$2%&!(*!;,7;(:(%1!&'2$;'$2%&!(*!'+%!-,2(*%! )20,*(&-!=%808!:(&+!)')7('+&!)2!(*/%2'%<2,'%!&+%77&>!)2!(*?%;'()*&!):!&',<7%!(&)')5%&! =&%%!2%/(%4!):!@+)22)71!%'!,78!ABBC>D!') !0%*%'(;!1(::%2%*'(,'()*!=/,2(,'()*&!(*! -(');+)*12(,7!E9F!=-'E9F>!,*1!-(;2)&,'%77('%!E9F!,*,7.&%&!=,&&(0*-%*'!'%&'&>>! =G,*%7!%'!,78!ABBHD!&%%!2%/(%4!):!I%10%;);3!%'!,78!ABBJ>8!!@+%!0%);+%-(;,7!,*1! (&)')5%!',00(*0!'%;+*(#$%&!,2%!52)-(&(*0!<$'!,2%!&'(77!(*!' +%!1%/%7)5-%*'!&',0%&! =@+)22)71!%'!,78!ABBJD!@+)22)71!%'!,78!ABBCD!I%10%;);3!%'!,78!ABBJ>8!! K%*%'(;!,552),;+%&!')!;)** %;'(/('.D!)*!'+%!)'+%2!+,*1D!+,/% !<%*%:('%1!:2)-! ,1/,*;%&!(*!('&!'%;+*)7)0.!4('+!7)4%2!;)&'&D!+(0+%2!/)7$-%!'+2)$0+ L 5$'&D!,*1!*%4! '))7&8! !F&&(0*-%*'!'%&'&!;,*!,7&)!;)**%;'!&5,'(,7!1(-%*&()*&!<%'4%%*!5)5$7,'()*&! ,&(1%!:2)-!(1%*'(:(;,'()*!):!(*1(/(1$,7!)20,*(&-&!(*!'+%!7);,7!5)5$7,'()*!=I%10%;);3! %'!,78!ABBJD!G,*%7!%'!,78!ABBM>8!!@+%!7(-(','()*!):!,&&(0*-%*'!'%&'&!(&!'+,'!&)-%'(-%&! ('!;,**)'! ;,5'$2%!-(02,')2.!2,'%&!)2!4+%*!,*!(--(02,*'!&%''7%1!(*')!,!7);,7! 5) 5$7,'()*!= G,*%7!%'!,78!ABBH>D!<$'!;,*!&)-%'(-%&!<%!'%,&%1!)$'!<.!'+%!,552)52(,'%! -)1%7!$&%1! (:!%*)$0+!%-5(2(;,7!1,',!,2% !,/,(7,<7%! = N,%*O L F0$1%7)!%'!,78 !ABB">8!! @+$&D!' +%&%!,&&(0*-%*'!'%&' &! ;,*!<%!/%2.!(*&(0+':$7!,*1!+%75!5,(*'!'+%!<(00%2!5(;'$2%! 4+%* !$&%1!4('+!)'+%2!7,2/,7!1(&5%2&,7!&'$1(%&!:2)-!)'+%2!1(&;(57(*%&!2%/)7/(*0! ,2)$*1!'+%!&,-%!-,2(*%!)20, *(&-!,*1!&5,'(,7!1(-%*&()*! = P)4%*!,*1!N5)*,$07%! ABB"D Q,*%!,*1!Q(*0!ABB"D! R)*%&!%'!,78!ABBH S!@,<7%!T >8!!

PAGE 21

! "# !"#$%&'( !$%&'&()!)*(*+&,!%--'.%,/*0!+.!+/*!1&.2.)&,%2!34*0+&.(0 5 6%7*(!8'.9!:%(*2!*+!%2;!<##= >; !"#$%$#&' %&()&*&' 5*27/.'(!,.'%2>!/%0!1*(*8&+*?!8 '.9!+/&0!%--'.%,/;!!@%490! %(?!,.22*%)4*0 !5<##= >!,.(0+'4,+*?!+/*!,ABC!2&1'%'D!8.'!+/*! *27/.'( !,.'%2!%(?!8.4(?! E !-.2D9.'-/&,!9&,'.0%+*22&+*!2.,& !&(!&+0 ! ;!! I%,/!9&,'.0%+*22&+*!,.(+%&(*?!%+!2*%0+!E!CC6!'*-*%+0;!!J&K*!.8!+/*!E!9&,'.0%+*22&+*!2.,&! +/*D!8.4(?!L*'* !:*(?*2&%( !%(?! +/*D! ?*0&)(*?!-'&9* '0!8.'! +/*9!8.'!40*!&(! %00&)(9*(+!+*0+0!40&()!$.2D9*'%0*!M/%&(!N*%,+&.(!5$MN>!58.'!)*(*'%2!.K*'K&*L!.8! 9&,'.0%+*22&+*0!%(?!$MN!0**!C--*(?&O!P>;!!P( !0410*34*(+!0+4 ?&*0!@%490!%(?! ,.22*%)4*0!5<##= > !L*'*!%12*!+.!8&(?!+'*(?0!&(!'*)&.(%2!&0.2%+&.(!.8! !+'%&()&*& Q )*.)'%-/&,!K%'&%+&.( 0!&(!&+0!,2.(%2!0+'4,+4'*!5<##R >Q!%(?!&?*(+&8D!%!-'.1%12*!1&. S .,*%(.)'%-/&,!8& 2+*'!8.'!2%'K%2!?&0-*'0%2!5@%490!%(?!$%'&0!<##R >; P+!&0!(.L!L&?*2D!'*,.)(&T*?!+/%+!-.-42%+&.(!,.((*,+&K&+D!0+4?&*0!.8!9%'&(*! .')%(&090!%'*U!5%>!%!1&. S -/D0&, %2!-'.12*9Q!51>!(**?0!%(!&(+*'?&0,&-2&(%'D!%--'.%,/Q! question.Weusethetermassignmentmethod'broadly toincludegeneticmixtureanalysis( Box2 )andparentage analysis( Box3 ),becausetheyusethesamebasicprinciples andarealsoactiveeldsofresearch. WhattypesofproblemscanAMsaddress? AMscanaddresstwobasictypesofproblem:classication andclustering( Table1 ).Whichformulationismore appropriatedependsonhowmuchpriorinformationone hasaboutthecategoriesofinterest(e.g.family,population andspecies). Inclassicationproblems,individualsareassignedto predenedcategories.Astandardapproachistocompute adiscriminantfunctionbasedonsamplesfrompotential sourcesandthenclassifyunknownstothegroupwiththe highestdiscriminantscore.InthecaseofAMs,thediscriminantfunctionistheexpectedgenotypicfrequency distributionundertheassumptionofHardyWeinberg andlinkageequilibriumineachsourcepopulation.AMs thatuseclassicationatleastinpartincludeATs,genetic mixtureanalysis,andparentageanalysis. Clusteringproblems [8] aremorechallengingbecause thecategoriesarenotpredened;instead,theymust themselvesbeconstructedfromthedata.Intheabsenceof sourcepopulationdatatoguideclassication,clustering methodsrelyonthepresenceoflinkagedisequilibrium, whichoccursinamixtureofindividualsfromdifferent populations [9,10] evenifallcontributingpopulationsare Box3.Parentageanalysis Parentageanalysis,whichinvolvesidentifyingtheparentsofspecic individuals [57,58] ,isaparticularcaseofATsandisaffectedbymany ofthesamestatisticalissuesasATsare [59] .Ideally,allpotential parentsaregenotypedandallbutonepaircanbeexcludedcategorically,basedonthemultilocusgenotypeoftheprogeny.Whenthis isnotpossible,fractionalparentageassignments(analogoustothe methodforanalyzinggeneticmixtures, Box2 )canbemade,basedon therelativelikelihoodsofdifferentpotentialparents [60] .Insome cases,itispossibletoreconstructgenotypesofunknownparents [58,61] .Blouin [62] recentlyreviewedDNA-basedmethodsforthe relatedeldofkinshipanalysis. Themethodsdescribedelsewhereinthispaperalldependonsome degreeofgeneticdifferentiationamongcandidatesourcepopulations. Insomecases,itispossibletoaddressthesametypesofquestion usingparentageanalysis,evenwhenthegroupsinquestiondonot differgeneticallyinanysystematicway.Thiscanbeaccomplishedby geneticallyidentifyingparentsofeachindividual(i.e.assigning'each individualtoitstwoparents)andthengroupingtheparents(andtheir respectivenumbersofoffspring)accordingtothetraitofinterest,such assizeortimeofreproduction [63] orhatcheryversuswildorigin [64] Thistypeofanalysishasalsobeenusedtostudymaleselection gradientsinplants [65] ,andrecentmodications [66] havebeenused toestimatepollendispersalcurves. Inthestudyofmatingsystems,onemightalsobeinterestedin differentquestions,suchaswhetherafamilyisamixtureofindividualsdescendedfrommorethantwoparents,whethermatingis randomorassortative,orwhethermalesandfemaleshavethesame numberofmates.Parentageanalysishasoftenprovidednoveland surprisinginsightsintomatingstructureandbehaviouralecology ofthestudiedspecies [57] .Typically,thisinvolvesmeasuringthe contributionofdifferentmalestotheoffspringofasinglefemale. Arecentvariationisdesignedtodetectsubfamilieswithinasingle batchofoffspring,basedonthepresenceoflinkagedisequilibrium causedbyamixtureofprogenygroups [67] Table1.Characterizationoftheprincipalassignmentmethodsinrelationtothebiologicalquestionaddressed a Statisticalmethod b ApproachAssignmentEstimateof allelefreq. c DistinctivefeaturesofmethodQuestions d Refs Classication AssignmenttestMLFreqFirstformulationofanAT;forcodominantmarkersO [1] (AT)MLFreqATfordominantmarkersO [48] MLFreqBayATallowingidenticationofmigrantsO,D [4] FreqFreqExclusiontestsO,D [12] Geneticmixture analysis MLFreqAssumesallsourcessampledandgenefrequenciesknown withouterror M [49] MLMLAllowsforunsampledsourcesandestimationofsourcegene frequencies M [50] BayBayBayesianimplementationM [18] BayBayForstudyingcolonizationprocessesM [16] MethodsforBayBayEstimatesmigrationratesD [30] answeringspecic questions BayBayIdentieshybridindividualsH [47] Clustering Methodsfor delineationof populations BayBayFirstmethodfortheidenticationofpopulations.Inference aboutnumberofpopulationsrequirestryingdifferentvaluesof thisparameter O,S,D,H [17] BayBayAsabove,butallowsforlinkedlociO,S,D,H [15] BayBayNumberofpopulationsisestimatedandtherangeofplausible valuesforthisparameterhasthenumberofsampled individualsasupperboundary O,S,D,H [14] BayBayTherangeofplausiblevaluesforthenumberofpopulations hasthenumberofobservedsubpopulationsasupper boundary O,S,D [13] a Thelistisnotexhaustiveandpresentsonlythelatestormostwidelyusedmethodsintheliterature;methodsofparentageanalysishavebeenrecently reviewedelsewhere [58] andwerenotincluded. b Abbreviationsindicatemethodusedineachstep:Bay,Bayesian;Freq,frequentist;ML,maximumlikelihood. c Forallelefrequencyestimationineachpopulation.Freq'indicatesthatthemethodusessampleallelefrequencies. d Abbreviations:D,dispersal;H,hybridization;M,geneticmixtureanalysis;O,originofspecicindividuals;S,populationdelineationandstruc ture. Review TRENDSinEcologyandEvolution Vol.20No.3March2005 138 www.sciencedirect.com

PAGE 22

! "" #$%!&'(!)*!#$!)+,-#+).,!/-0',**!1,+2,,$!30%,4)$5!#$%!,3/)-)'#4!%#+#!'044,'+)0$! &26)4,!'0$$,'+).)+7!30%,4*!6#.,!8) 3/-0.,%9:!30-,!,3/)-)'#4!%#+#!#-, !$,,%,%!+0! .,-);7!+6,)-!-01<*+$,**!#$%!.)', = .,-*#!30%,4*! 6,4/!%,*)5$!;<+<-,!;),4%!*+<%),*(! & >,-$,-!,+!#4?!@AAB (?!!!C<'',**;<4!%)*/,-*#4!)*!+6,!/-)3,!30.,-!0;!/0/<4#+)0$! '0$$,'+).)+7!#$%!+6,!30*+!)3/0-+#$+!%)*/,-*#4!*+#5,!0;!3#-)$,!1,$+6)'!0-5#$)*3*!)*! )+*!4#-.#4!*+#5,?!!! D'+<#4!+-#'E)$5!0;!4#-.#,!)*!6#3/,-,%!%<, !+0!)+*!*3#44!*)F,9!4#-5,! */#+)#4!#-,#*!&'03/#-,%!+0!)+*!*)F,(!#$%!+6,!'03/4,G)+),*!0;!0',#$05-#/6)'!/67*)'#4! /-0',**!'03/0<$%,%!2)+6!4#-.#4!1,6#.)0-?!!H,2!+-#'E)$5!+,'6$)I<,*!#-,!1,)$5!<*,%9! 0$,!0;!+6,3!<*)$5!+6,!5,$,+)'!#//-0#'6!0;!#**)5$3,$+!+,*+*?!!D4+ 60<56!+6)*!#//-0#'6! %0,*!$0+!5).,!+6,!-,*,#-'6,-!#'+<#4!4#-.#4!+-#$*/0-+J/#+6*!26)4,!)+!)*!/,4#5)'9 !)+!'#$! 5).,!%)*+#$',*!1,+2,,$! 26,-,!+6,!0-5#$)*3!2#*!*<'',**;<447!-,'-<)+,%!#$%!;-03! 26)'6!*<1 = /0/<4#+)0$!)+!'#3,!;-039!5).)$5!#'+<#4!%)*+#$',*!0;!%)*/,-*#4 ?!! D4+60<56!30%,4*!#$%!+6,!<$%,-*+#$%)$5!0;!+6,!)$+,-#'+)$5!/-0',**,*!0;! /0/<4#+)0$!'0$$,'+).)+7!6#.,!)3/-0.,%!*)5$);)'#$+479!+6,-,!)*!*+)44!#!4#'E!0;!,3/)-)'#4! %#+#!;0-!#$7!0$,!3#-)$,!0-5#$)*3!+0!%#+,?! K6,!/<-/0*,!0;!+6)* !+6,*)*!/-0L,'+!)*!+0! '03/)4,!# $%!#%%!+0!+6, !,G)*+)$5!,3/)-)'#4!%#+#!#**0')#+,%!+0! !"#$%$#&'%&()&*& 9!)$! +6,!*/#+)#4!*'#4,!0;!+6,!M#70*!M0'6)$0*!NOD9!26)'6!'#$!60/,;<447!1,!<*,%!)$!;<+<-,! *+<%),* ?!! > )+6)$! +6)*!+6,*)*!)*!+6, !'0$+,G+!0;!+6,!*)+,!)$!+,-3*!0;!1)05,05-#/679!*03,! $,2!3#/*9!#$% !# $!#++,3/+!0;!#**)5$3,$+!+,*+*!;0! !+'%&()&*& !'040$),*!/-,*,$+!#+!+6,! *)+,?! K6)*!+6,*)*!)*!#!*3#44!*+,/J'0$+-)1<+)0$!+02#-%*!+6,!4#-5,-!/)'+<-,!0;!/0/<4#+)0$! '0$$,'+).)+7!;0-! !"#$%$#&'%&()&*& !)$!M#70*!M0'6)$0*9!P0$%<-#*? !

PAGE 23

! "# #" $%&'$()*' $ ()*'+ !$%&'(&()*'!+,&-.!/,0*1(!2*3,4!2&5*!61&'7,4!2&5*0!2*-.)'*0 ,)-&$./)0/)*1$2/'3+ !+&5!80%&'704!9*'7:1&0!;)7,'()<)-&()*'!':=>,1?!96@A (45 6 /'-)07$8+ !B*1(.!9*'7:1&0!2*&0( 9:0/'-)07+ !C,0(,1'!2&1)>>,&'DE,0*&=,1)-&'!/,,+ !G1*H)-&%!I(%&'()! 8!)'-%:7,7!&%%!*)*J,*J1&H.5! M !(.,!0(:75!*:()*'0! *:(!F.,1,!&'7!.*F!)(!<)(0!)'!(.,! %&1J,1!H)-(:1,!)0!&!H&1&=,(,1!(.&(!F,!0.*:%7!&%F&50!>,!&F&1,!* V 1,J)*'!W!7,0)J'&()*'0!-*=,!<1*=!(.,!X-*%*J)-&%!2*'0,13&()*'! $%&'')'J!;X2A!<*1!(.,!E,0*&=,1)-&'!2&1)>>,&'!/,,)*J,*J1&H.)-!-%&00)<)-&()*'!050(,=!<*1!E&1)',!X-*1,J)*'0!*&%!0-&%,! 7*F'!(*!(.,!0H,-)<)-!0)(,N

PAGE 24

! "# !"#$%&'( ) !$%&&%'()*!+!,-./(./0%12-'!0(%&3*!4%5(6!70.3! !"#$%#&'()*"+,)-$.+/0(+120+&3$&4$53+6)-/ 7 $ ' ' ' '

PAGE 25

! "# !"#"$ %&'$()*+,-.'$/-0$1'/234$%&'$5*)6&7'86')-$%)*9,./2$:62/-6,.$,-$ 6&'$ %)*9,./2$:62/-6,. $ $ $ ;,<=)'$> 4$ $%&'(!)%*+,*+-'./%0!1-'2,3*-4!*1!5,'(26!'&7!.-*8%&0,69!:';!)%*+,*+-'./%0!-,'(26!3%-*8%&0,6!3%('&<'<%*&!H,'0/!5,6*-
PAGE 26

! "# "#"#! $%&'()*&+,!-(./('+!01'*22(1+34(.&15('*%1+!01'*22(1+!6((7! 892'()*&+!:,!;&'/<('+!=&+>9 '1.!0&1./ $%&!'&()*+&,-.*/!0*,-11&*/!2&&3!4'5026!&78&/9(!":;;;<+!*=)/>!8%&! .)*(8=-/&(!)3!8%&!8-?!)3!8%&!@A.*8*/!?&/-/(A=*!'&7-.):!B&=-C&:!DA*8&+*=*!8)!8%&!B* E! F(=*/ 9(!)3!G)/9A,*(!4 H->A,&!I 6J!!!F8!*??,)7-+*8&=E!%*(!K;;!+-=&(!)3!,&&3!L-8%!)M&,!NN! (?&.-&(!) 3!(8)/E!.),*=!*/9!)M&,!#;;!(?&.-&(!)3!3-(%! 40=-38)/!*/9!0=-38)/!"IIO 6J!! $%&!'502!&.),&>-)/!-/.=A9&!*!8&,,&(8-*=!.)+?)/&/8!8)!-/.=A9&!8%&! 1)A/9*,-&(!)3!8%&!+*P),!L*8&,(%&9(!8%*8!9,*-/!-/8)!-8(!+*,-/&!.)+?)/&/8J!!$%&!(A1 Q ,&>-)/(!*,&!.=*((-3-&9!1E!1-)9-M&,( -8E!9-33&,&/.&(!3,)+!).&*/)>,*?%-.!?*88&,/(:!,&&3! (8,A.8A,&!*/9!9-(8,-1A8-)/:!L*8&,(%&9(:!*/9!8&,,&(8,-*=!3*.8),(!=-<&!,*-/3*==!*/9! &=&M*8-)/!4R,*+&,!*/9!R,*+&,!S;;S6J $%&!T),8%& ,/!G)/9A,*(!0)*(8U(!1)A/9*,E!-( !3,)+!8%&!V= W *!2-M&,!8)!X*8A* 2-M&,!)3!G)/9A,*(!*/9!-/.=A9& (!8%&!B*E!F(=*/9(!4 H->A,&!"; 6J ! ?*)9'(!@ !H-/*=!1-)>&)>,*?%-.!3,*+&L),!&.),&>-)/(!8*<&/!3,)+!'YZ[!4\?*=9-/>!&8!*=J! S;;K6J!!$%&!X=*/8*8-)/!B&*.%!2&(),8!0)M&!-(!-/!8%&![&(8&,/!0*,-11&*/!4&.),&>-)/!NO6J Articles 580BioScience July/August2007 / Vol.57 No.7www.biosciencemag.org Figure 3.Final biogeographic framework,showing ecoregions.Ecoregions are numbered and listed in box 1.

PAGE 27

! "# ! !"#$%& '( ) !$%&!'&()*+&,-.*/!0*,-11&*/!2&&3!&.),&4-)/5!$*6&/!3,)+!7,*+&,!*/8!7,*+&,!9:;;:<5 Ecoregional Conservation Planning for the Mesoamerican Caribbean Reef7 Figure 1.Mesoamerican Caribbean Reef Ecoregion Base map of the region includes major rivers,lagoons,lakes,urbanized areas,coral reefs,mangroves,land elevation,bathymetry,and ecoregional boundary. INTRODUCTION MESOAMERICANIDENTIFYING REPRESENTATIVENESS DATA AVAILABILITY CONSERVATION CARIBBEAN REEFPRIORITY AREASOF PRIORITY AREASAND INFORMATION GAPSOPPORTUNITIES

PAGE 28

! "# !"#$%&'() !$%&'()*+,-!+.!/0(!12345!6"7!8+'/0(',!9%*,/:,:!4++! ; !3+<%=(>?!6@7!$*:,!A:B:,! ; 2=&(')*-!6*,C>%D*,)!30(/%=:>!E:F?!6G7!E(>*<(!E:''*('!4((.!$F-/(=!6&:''*('!'((.?! :/+>>-?!-0:>>+H! C+:-/:>!0:&*/:/-7?!6I7!J%>.!+.!K+,D%':-?!6L7!8+'/0(',!K+,D%':-!3+:-/!6*,C>%D*,)!/0(!E:F!M->:,D-7?!:,D! 6N7!OP(,!OC(:,!6(Q)Q!R%C:/:,!3%''(,/?!J%>.!+.!K+,D%':-!JF'(?!O..-0+'(!&:,S-7Q!!T:S(,!.'+=!A':=('! :,D!A':=('!6@UU@7Q +,-,' ./&'012'34516748 '9:67$%14 T0(!E:F!M->:,D-!+.!K+,D%':-!C+,-*-/!+.!:PP'+V*=:/(>F!@UU!=*,+'!*->:,D-! *,C>%D*,)!/0(!>:')('!*->:,D-!+.!4+:/ W ,?!X/*>:?!E:'&:'(/:?!J%:,:Y:?!:,D!3:F+-!3+C0*,+-Q!! T0('(!:'(!'((.!P:/C0(-!:>+,)!/0(!C+:-/!+.!K+,D%':-?!&%/!*/!*-!/0(!E:F!M->:,D-!/0:/!:' (! .'*,)(D!&F!H(>> Z D([(>+P(D !'((.-!6 O>-+,!:,D!\*,('-/(*,!@UU@?!$P:>D*,)!(/!:>Q!@UU#?! ]*>S*,-+,!@UU^?!K4M7Q!!M,!/ 0(!_3!'(P+'/!/0(!E:F!M->:,D-!H('( !*D(,/*.*(D!/+!&(!+.! `K*)0!a'*+'*/Fb!.+'!&*+D*[('-*/F!*,!/0(!(C+'()*+,!&(*,)!:!P'*+'*/F!:'(:!+.!+[('>:PP*,)! /:V: !6C+':>?!.*-0?!P>:,/?!:,D!/0(!.+C:>!-P(C*(-!+.!/%'/>(-?!=:,:/((-?!:,D!-(:&*'D-7! Misteriosa and the MACR region via strong westerly currents that are prevalent much of the time. Therefore, the eastern limits of the ecoregion boundaries established at the workshop were extended to the banks of Rosario and Misteriosa around the Swan Islands and up to include portions of the upwelling zone off the Yucat‡n Peninsula. Subregional divisions within the ecoregion were also moved to coincide with watershed boundaries and adjusted to follow the 1,000-m contour between coastal and oceanic areas. This standardization allowed for a more rigorous analysis of the representation of habitat types within each of the subregions,as can be seen in Tables 16-18. In some cases,boundaries of the original subregions were merged together to better conform to geoand hydromorphic boundaries. The Chetumal Bay subregion was merged together with the Sian Ka'an-Ambergris subregion and designated a subunit of this larger area. Similarly,the Bay Islands were incorporated as a subunit with the Northern Coast of Honduras subregion. The final subregional boundaries, described in Table 1,were presented and discussed at the Cancun Workshop. Final Subregional Boundaries for MACR 1.Northern Quintana Roo Cozumel 2.Sian Ka'an Ambergris (including Chetumal Bay) 3.Belize Barrier Reef System (barrier reef, atolls, shallow coastal habitats) 4.Gulf of Honduras 5.Northern Honduras Coast (including the Bay Islands) 6.Open Ocean (e.g., Yucat‡n Current, Gulf of Honduras Gyre, Offshore banks). Ecoregional Conservation Planning for the Mesoamerican Caribbean Reef11 Figure 2a.Preliminary MACR ecoregional and subregional boundaries (dark line) selected at the WWF experts Workshop in Belize City,April 1999. Figure 2b.Adjusted MACR ecoregional and subregional boundaries (dark line) designed for WWF's Ecoregional Planning Workshop,Cancun 2000. Modifications were based on updated biophysical information. INTRODUCTION MESOAMERICAN IDENTIFYING REPRESENTATIVENESS DATA AVAILABILITY CONSERVATION CARIBBEAN REEF PRIORITY AREASOF PRIORITY AREASAND INFORMATION GAPSOPPORTUNITIES

PAGE 29

! "# $%&'()&!'*+!%&'()&!,--,./!!012'3)+!'3!34)!54)'+!6'3)&78!19!34)!:;<=!>3!>7! 7?7@)23)+!31!A)!'!@177>AB)!71?&2)!91&!B'&C'B!+>7@)&7'B!19!34)!)21&)D>1*!$E@'B+>*D! ,--FG!H>BI>*71*!,--# G!J=K./ !"#$%&'(( ) !L4)!M'N!K7B'*+7!$>+)*3>9>2'3>1*!*?(A)&O!JPQ.!>7!&'*I)+!5J>D4)738!'7!A>1+>C)&7>3N!@&>1&>3N! '&)'!6>34!'!9?3?&)!34&)'3!&'*I>*D!19!5J>D4!L4&)'3/8!!L'I)*!9&1(!%&'()&!'*+!%&'()&!$,--,./ *+,+' -./01'-023"401 <'N17!<124>*17 !>7!'!D&1?@!19!>7B'*+7!21*7>73>*D!19!34)!361!('>*!>7B'*+7!$<'N1! :'N1&!'*+!<'N1!:)*1&.!'*+!"Q!7('BB)&!21&'B!2'N7!B12'3)+!"R!(>B)7!*1&34)'73!19!0'! 96Ecoregional Conservation Planning for the Mesoamerican Caribbean Reef Map C3. Future Threat Ranking

PAGE 30

! "# $%&'()!!*+!"##,!(!-./01!/2!&+3&4&30(56!2./7!89%!1.&4(8%!6%:8/.!;&89!89%!9%51!/2!<=*>(80.(5!I(.&+/!<.:9&1& K5(-/! $(F/6!$/:9&+/6! !?I(.&+%!>(80.(5!I/+07%+8A !/2!B/+30.(6 !? <11%+3&:%6!***!(+3!*=A )!! *8!:/4%.6!LM#)GN!O7 G !(+3!&6!68&55!7(+(-%3!'F!89%!B$CD!(+3!&6!1(.8!/2!(!+%8;/.O!/2! I J<6!89(8!61(+!89%!;9/5%!I<$C)!!*8 !&6!.%:/-+&P%3!(6!(+!&71/.8(+8!(.%(!'F! %+4&./+7%+8(5!:/+6%.4(8&/+!/.-(+&P(8&/+6)!!*8!&6!5/:(8%3!/+!(! 69(55/;%.!1(.8!/2!89%! 69%52!(+3!&6!606:%18&'5%!8/!6%3&7%+8!(+3!+08.&%+8!5/(3&+-!2./7!89%!7(&+5(+3!?Q@R@! S*+8%. +%8TS013(8%3!GH"HTA)!!! !"#$%&'() !I(.&+%!>(80.(5!I/+07%+8!/2!$(F/6!$/:9&+/6U!B/+30.(6)! V(O%+!2./7!I/+07%+8/!>(80.(5! I(.&+/!?GHHMA) ? J5(+8(8&/+! E%(:9!C%6/.8!:/4%!1/&+8%3!/08!'F!'5(:O!(../; A )

PAGE 31

! "# !"#$%&'() !$%&'(!$')*+,'( -!.',/01%( 2!3%45,!61'7!8',075,9'!:%901%;!8%1+,'!<"##=>2 !2 3*515!E515!%9!;5%(9!FF!(C5)+5(!'6!)'1%;(-!GG!(C5)+5(!'6! ')9')'1%;(-!H!(C5)+5(!'6! %,9+C%9*%1+%,(-!%,/!""F!(C5)+5(!'6!6+(*!15C'195/!+,!9*5!;%95!IJJ#K(!<$;+69',!%,/! $;+69',!IJJ=-!L0M7%,!IJJ=%-!IJJ=D>2 +,-,' ./01202"31'4&056'7&83%2'93:& ?;%,9%9+',!@5%)*!A5('19!$'B5!+(!;')%95/!',!9*5!('09*E5(951,!(+/5!'6!9*5! +(;%,/! $%&'!8%&'1!%,/!+(!*'75!'6!9*5!',;&!9'01+(9!/5(9+,%9+',!+,!9*5!8?N O !!9*5 ?;%,9%9+',!@5%)*!A5('192!!P9!*%(!%!(*'15;+,5!'6!%CC1'Q+7%95;&!I=H!75951(!E+9*!1')4! 6'17%9+',(!%9!D'9*!5,/(2!!3*515!%15!,5%1!(*'15!)'1%;!C%9)*5(!,5(9;5/!%;',R!9*5!1')4! 6%)5!%9!+9(!5,/( !%,/!9*5!6+1(9!)'1%;!E%;;!+(!%CC1'Q+7%95;&!I##!75951(!61'7!9*5!(*'15! E+9*!/5C9*(!'6!'B51!"#!6559!%,/!%9!('75!C%19(!'6!+9(!)15(9!S0(9!0,/51!F!65592!!3*+(!6+1(9! 61+,R+,R!)'1%;!1556!6'17%9+',!61'7!9*5!(*'15!+(!(5C%1%95/!D&!%!,%901%;!)*%,,5;!E*+)*

PAGE 32

! "# !"#$%&'() !$%&'!(')*!+')*,-!!.'/01!2,*3!+*143015*!6'54,'&!+',71*!8"99:;!8<&'15'57*1!=0'>?! @0%*,5!A*7150B!*45!C)!C&'>/!',,*D ;! C*'5%!4%0!'%!5?0!'AA,*'>?!5*!5?0!%?*,0!'1B!D?7>?!B0&710'50%!D?'5!$!>'&&!5?0!&025!>*,'&! A '5>?!'1B!,7E?5!>*,'&!A'5>?!8 F7E4,0!#G;-!!!.?0,0!7%!%'1B)!C*55*3H!5?01!%0'E,'%%!C0B%! '%!)*4!'AA,*'>?!C*5?!A'5>?0%!2,*3!5?0!%?*,0-!!.?0,0!7%!%7E1727>'15&)!&0%%!3'>,*!'&E'0! >*I0,!*1!5?0%0!A'5>?0%!>*3A',0B!5*!5?0!10',!%?*,0!>*,'&!A'5>?0%-!!.?0!&025!>*,'&! A'5>?!?'%!3*,0! !"#$%$#&'%&()&*& !> *&*170%!*I0,!5?0!,7E?5!>*,'&!A'5>?!'1B!D'%! >?*%01!'%!5?0!3'71!%'3A&71E!%750!2*,!37>,*%'50&&750!J6K!'1'&)%7%-!

PAGE 33

! "" !"#$%&'() !#$%&'%'()&!*+%,-!.+/)0'!1)2+3!4%5+&!60)7!#$%&'%'()&!*+%,-!.+/)0'!8"99:;3!!10+%'+?!2(/('(&@!/,A>%!<(2+7%/'+0/!3

PAGE 34

! "# !"#$%&'() !$%&'(&()*'!+,&-.!/,0*1(!2*3,!4&5!0.*6)'7!0.*1,%)',!&'8!%*-&()*'!*9!1,,9!5&(-.,0!-%*0,0(! (*!0.*1,:!;%%<0(1&(,8!=>!&<(.*1: !"#$%&'(+ !?<(.*1@0!)%%<0(1&()*'!*9!%,9(!-*1&%!5&(-.!0.*6)'7!9**(51)'(!*9!(.,!1,,9!6&%%:!!A<4=,10!1,9,1! (*!(.,!&551*B)4&( ,!8,5(.0!*9!(.,!6&%%!)'!9,,(:!!?%0*!0.*6'!)0!(.,!&551*B)4&(,!%*-&()*'!*9!&!04&%%!-&3,! *'!(.,!0)8,!*9!(.,!1,,9!6&%%:

PAGE 35

! "# !"#$%&'() !"#$%$#&'% &()&*& !$%&%'(!&%$)*+%',!%'!*-.!&./*!$%0)&!1)*$-!%/!2&)'*)*+%'!3.)$-!4.,%0*!5%6.! +'!5)(%,!5%$-+'%, 7!8%'9:0),!;<:*-%0=,!+&&:,*0)*+%'>?! ! +,-,'!"&./'01/'203'4&567/8 +,(,' !"&./'4&567/8 +,(,(,' 409'40:"1# @)1!A)B+'C!D),!$%'9:$*.9!9:0+'C!*-.!,:AA.0!%/!"EEF?!!G!D),!0.,*0+$*.9!*%! %'&(!,'%0B.&+'C!*%!A)B.!A(!A.),:0.A.'*,!/%0!*-.!A)1?!!HI:+1A.'*!:,.9!*%!A)B. A.),:0.A.'*,!D.0.J!*D%!*)1.!A.),:0.,!;"K!)'9!KE!A.*.0,>7!*D%!.A1*(!1&),*+$!

PAGE 36

! "# $%&&'( ) *+,-.!/'(0%+(-1*2!03'!# ) 4'5(.!3-+$60*2!'(-!" ) 4'5(.!3-+$602!7+8-!9:!'5(/-! -;40*2!3+1-2!.+8+($!/';4%**2!<-&&'3!(<&'(!1'4-2! %(.!%!.+8-!*&%0-? !!@!/'(*015/0-.!%!7&'%0+($!.-8+/-!3+06!*(%4!6''>*!0'!6%($!-A5+4;-(0! 0'!>--4!;-.!5*+($!06-!"!4&%*0+/!$%&&'( ) *+,-.! /'(0%+(-1*!0+-.!0'!%!# ) 4'5(.!3-+$60!0'!>--4!06-;!+(!4&%/-?!!K(-!-(.!'7!06-!0%4-! ;-%*51-!3%*!6''>-.!0'!'(-!;%1>-1!%(.!;-%*51-;-(0!0%>-(!%0!06-!'06-1!;%1>-1?!! L'!/';4-(*%0-!7'1!06-!0%4-!;-%*51-! *%$$+($!+(!06-!;+..&-!=!7'1!/518+($!71';!3%8-*!;'8+($!0'3%1.*!06-!*6'1-2!@!6''>-.!'(!9 ) #!3%0-1! ='00&-*!0'!06-!0%4-!H.-4-(.+($!'(!+0*!&-($06!=-+($!5*-.I!0'!1%+*-!+0!54!%(.!0'!/6-/> 06-!&+(-!=!'(!06-!*-%7&''1?!!P6-(! 06-!&+(-!'7!*+$60!3%*!*01%+$60!%(.!06-1-!3%*!('!%44%1-(0!0+&0+($!'7!06-!$%&&'(! /'(0%+(-1!'(!06-!'06-1!-(.2!@!;%1>-.!06-!0%4-!;-%* 51-!3+06!;!06-!/';4%**!1-%.+($!%(.!;-%*51-.!06-!.-406!'7! -(.4'+(0?!!L'!0%>-!06-!(-Q0!;-%*51-;-(0*2!@!;'8-.!'(&-1*!7'1!-%/6!;-%*51-;-(0!0'!>--4!06-!'06-1!;%1>-1!%0!06-!*%;-!-(.!4'+(0! '7! 06-!41-8+'5*!;-%*51-;-(0?!!J(.!4'+(0*!3-1-!/6'*-(!8+*5%&&+($!%0!06-!%/05%&!

PAGE 37

! "# $%%&'()*&+,-(./&-(0!%$!&10!(00$!2/334!5-,1!&1/&!'%)*&5!20(0!,1%50*!210(0!&10!2/33! 60*707!%-&!%$!5)81&9!!:,&-/3!,-(./&-(05!%$!&10!(00$!2/33!20(0!/''(%;) ?)8-(0!@A B 9!! !"#"$"%&'()*% +),-*./0% % C%330,&)%*!%$!,%(/3!<-,-5!$(%0;,0'&!,%3%*)05!@G@!&%!@G#4!210(0!%*3=!"!5)&05!'0(!,%3%*=!20(0!5/<'307B4!(05-3&)*8! )*!FG!<-,-5!5 /<'3059!!L$!&10!IJ!,%3%*)054!KK!20(0!%*!&10!M0$&!C%(/3!N/&,1!%$! N3/*&/&)%*!O0/,1!P05%(&!C%.0!>NOPCB4!K!)*!/*!/7Q/,0*&!,%.0!5%-&1!%$!N3/*&/&)%*! O0/,1!P05%(&!C%.04!K!*0/(!&10!51%(03)*0!$(%*%(&1!%$! NOPCB4!/*7!K!5/<'305!0/,1!$(%3%,/33=!S*%2*!/5!TD/*),0R5!C%.0U!/*7! TH%5')&/3UB!* 0/(51 %(0!%$!C/=% !V0*%( 9!!!W10!3%,/&)%*5!%$!"G!%-&!%$!&1050!KK!,%3%*)05 4! (03/&).0!$(%?)8-(0!@E B9!! W1050!"G!,%3%*)05!20(0!/35%!&10!$)(5&!5/<'307 !/*7!&10)(!<-,-5!2/5!,%330,&07! 608)**)*8!/&!KXIJ/J!,%3%*)05!'0(!,%330,&)%*!&()'B9!!W10!0/(3=! <%(*)*8!,%330,&)%*!&)<0!2/5!,1%50*!60,/-50!%$!/!'(%%$!)*!,%*,0'&!)*.05&)8/&)%*!%$! <-,-5!30.03!'(%7-,&)%*!&1/&!2/5!7%*0!)*!&10!'/5&!6=!&1)5!)* .05&)8/&%(9!!O=!,%330,&)*8! <-,-5!%*!&10!1%-(!/&!0.0(=!1%-(!$(%.)5-/3)Y07!6=!1/*7 Z ,0*&()$-8/&)%*!%$!&10!5/<'30! /*7!/''(%;)60&200*!&10!1%-(5!%$!I!/*7!#/
PAGE 38

! "# $%&'(!&)'*'!+!,-..',&/-0!&(/1*2!3'/04!&)'!-0.5!/06'*&/47&-(!-8&!/0!&)'!97&'(!/0! &)'!:7(;!)70:./04!7..!&)'!'<8/1='0&!>*5(/04'*2!&83'*2!9(/&/04!&73.'&2!70:!%.7*)./4)&*?! 1(-6':!&-!3'!,8=3'(*-='! 70:!7!1-**/3.'!*7%'&5!(/*;@!!$.*-2!&)'!80*7=1.':!'.;)-(0! ,-(7.!,-.-0/'*!9'('!=8,)!%8(&)'(!7975!%(-=!&)'!3'7,)!'0&(5!1-/0&@!!A)8*2!7!*/:'! /06'*&/47&/-0!-%!,-..',&/04!=8,8*!:8(/04!&)'!:75!/0*&'7:!-%!&)'!:7(;!'7(.5!=-(0/04! )-8(*!97*!,-0:8,&':@!! A)'!18(1-*'!%!&)/*!*/:'!/06'*&/47&/-0!97*!&-!1(-6'!&)7&!&)'!,)704'!/0! ,-..',&/-0!&/='!9-8.:!0-&!7%%',&!&)'!*8,,'**!-%!&)'!1(-B',&@!!!C&!9-8.:!7.*-!)76'!&)'! 7::':!3'0'%/&*!-%!3'&&'(!6/*87./D7&/-0!-%!*7=1./042!1(-,'**/04!-%!&)'!*7=1.'*!:8(/04! :75./4)&!)-8(*2!70:!1('*'0, '!-%!-&)'(!1'-1.'!&-!,)',;!-0!&)'!/06'*&/47&(E*!.-,7&/-0! 70:!*7%'&5@!!F',78*'! &)'!&7(4'&!08,.'/,!7,/:!97*!GH $!70:!&)'!1(-B',&!97*!0-& !&-! /06'*&/47&'!4'0'!'I1('**/-0*2!,-0*/*&'0,5!-%!&)'!&/='!-%!:75!9)'0!=8,8*!97*! ,-..',&':!9-8.:!0-&!7%%',&!&)'!&-&7.!1(-B' ,&@!!A)'!1(/0,/17.!,-0,'(0!97*!,-..',&/04! 711(-I/=7&'.5!&)'!*7='!7=-80&!-%!=8,8*2!,-=17(':!&-!&)'!1(' J :8*;!,-..',&/-02!35! 6-.8='2!*8,)!&)7&!711(-1(/7&'!7=-80&*!-%!GH$!,70!3'!'I&(7,&':!%-(!&)'!%8(&)'(! 707.5*/*@ A)'!*/:'!/06'*&/47&/-0!,-0*/*&':!-%!(' J *7=1./ 04!,-.-0/'*!K! L !M!>&)'!%/(*&! ,-.-0/'*!*7=1.':?!:8(/04!&)'!:75@!!N-..',&/-0!97*!:-0'!7&!+OPP1=@!!A)'!&/='! 3'&9''0!&)'/(!/0/&/7.!*7=1./04!/0!&)'!'7(.5!=-(0/04!70:!&)/*!*7=1./04!97*!Q!:75*@!!!C&! *)-9':!&)7&!=-('!=8,8*!97*!,-..',&':!:8(/04!&)'!:75!,-..',&/-0!6'(!& )'!'7(.5! =-(0/04!,-..',&/-0!> A73.' !" ?@!!C&!/*!*8*1',&':!&)7&!=-('!=8,8*!97*!,-..',&':!3',78*'! &)'!/06'*&/47&-(!,-8.:!*''!3'&&'(!:8(/04!&)'!:75!70:R-(!)/*!&',)0/<8'!/0!,-..',&/-0!

PAGE 39

! "# $%&'()*+!()*'!,$%*-!!.'(%!,/$0!&($1,!(12!,/*!'*0,!(3!%4540!5(66*5,$(1!780 !5(1+45,*+! +4'$19!,/*!+8:-!! !"#$%&'( !;(%&8'$0(1!(3! ,/*! &*'5*1,89* !(3!&*66*,!0$<*0 !(3! %4540! 08%&6*0 !5(66*5,*+ !=*,7**1!>8:!8 1+! ?'* @ +40A!5(66*5,$(1!,$%*0!B 8&&'(C$%8,* +!)$04866:D ! )"* !B&*'5*1,89*!(3 +,% ./01 !B&*'5*1,89*!(3 08%&6*0 !(4,!(3!EFD!!!!08%&6*0!(4,!(3!GHD 2%.3/4&5%$$%6 !!!!IJ !!!!! "E 74"$$ 4%.3/4&5%$$%6 !!!!GE !!! H 74"$$&5%$$%6 !!!!EK !!! F"-I 8%,*&04"$$&5%$$%6 & !!!!!J !!!!! E"-I >8:!5(66*5,$(10 !866(7*+!3('!08%&6$19!34',/*'!878:!3'(%!=*85/!*1,'815*! &($1, L!EG!5(6(1$*0!7*'*!08%&6*+!34',/*'!0(4,/!(3!,/* !M*3,!;('86!?8,5/ 2!G!5(6(1$*0! 7*'*!08%&6*+!3'(%! ?41,8!?*6$5818 !B1*C ,!5()*!1(',/!(3!?NO !5()*D2!G!5(6(1$*0!3'(%! ?41,8!;8 P 8!N818 !B1*C ,!5()*!0(4,/!(3!?NO 5()*D2!81+!F!5(6(1$*0!3'(%!;8:( !Q*1('!BG! 3'(%!R81$5* S0 !;()* !81+!G!3'( %!T(0&$,86 D!B .$94'*!EK D! ;(6(1$*0!7*'*!)$04866:!$+*1,$3$*+!+4'$19!,/*!+8:!81+!%8'A*+!7$,/!14%=*'*+! 36890-!!U54=8!+$)$19!780!1(,!*%&6(:*+!3('!083*,:!81+!3$1815$86!'*80(102!,/40!(16:! 5(6(1$*0!,/8,!7*'*!8&&'(C$%8,*6:!7$,/$1!G!%*,*'0!(3!+*&,/!7*'*! 08 %&6*+!B*C5*&,! 3'(%!?41,8!?*6$5818 !81+!,/*!T(0&$,86!=*5840*!,/*!0/866(7*0,!*6A/('10!7*'*!8,!H!,(!F! %*,*'0!+**&D-!!! !

PAGE 40

! "# $% &% !"#$%&'() !'$(!)*+,-./!0*1!)-01)!,*121!3+2$4!)$5(41)!,121!3+44130167!$%! 8! 9 :4$.0$0-+.!;1$3*!<1)+20! =3+4+.-1)!8 9 >>%? !+2$./1!&+@!-.6-3$01)!A1B0!C+2$4!:$03*?!" 9 !D*1!0-(!+B!:E.0$!C$ F$!;$.$!=3+4+.-1)!GH 9 G"%?!> 9 !:E.0$!:14-3$.$! =3+4+.-1)!G> 9 GI %?!&% G! 9 J$ .-31K)!C+L1!=3+4+.-1)!>G 9 >M%?!$.6!I! 9 !N+)(-0$4! =3+4+.-1)!>O 9 ># %P =:-30E21)!0$Q1.!B2+5!'+.E51.0+!R$0E2$4!'$2-.+!="HHS%%P

PAGE 41

! "# $%&'!()&)*!*%(+,-!.%*!&/,,-&0-1!)*234!%!5#(6!*0-72,-!*87234-!9+%&:%4-! /+-3-1!)31-7.%0-7;!%31!07%3*<-77-1!0/!%!+7 = ,%>-,-1!5?(6!*0-72,-!+/,8+7/+8 ,-3-! @2%,!%>/@-!0'-!*)7<%&-!/-%&'A!!C0!*'/7-D!0'-!*%(+,-*!.-7-!&-3072<)4-1!>8!'%31D!0'-!*)+-73%0%30! .%0-7!12*&%71-1!%31!0'-!7-*),0234!()&)*!+-,,-0!9.20'!%38!1->72*;!.%*!07%3*<-77-1!0/! %!*0-72,-!5A?(6!(2&7/&-3072<)4-! 0)>-!)*234!%!+2+-00-A!!B'-!*%(+,-!.%*!+7-*-7@-1!>8! 0/++234!0'-!(2&7/&-3072<)4-!0)>-!.20'!EFC,%0-7!9C(>2/3;!%++7/G2(%0-,8!5#H!>8! @/,)(-A!!$%&'!0)>-!.%*!,%>-,-1!.20'!IJKEL!M!&/,/38!3)(>-7D!8-%7D!%31!23@-*024%0/7N*! 23202%,*A!!B'-!*%(+,-*!.-7-!0'-3!*0/7-1!23!% !&/3@-302/3%,!<7--O-7!)302,!1-+%70)7-! <7/(!0'-!<2-,1!*20-A!!B'-!*%(+,-*!.-7-!:-+0!/3!2&-!23!%!&//,-7D!-G&-+0!A!!9F/0-T!U/7!5!.--:!1)7234!0'-!*)((-7!/)2,1234!.%*!*')0!1/.3!/@-!<7--O234!+/230;A !"#"$ %&'$()*+ ,-. / $ $ B'-!,%>!&/(+/3-30!.%*!&/31)&01!>-0.--3!0'-!(/30'*!/-7D!V#5# %31!C+7 2,D! V#55A $$ R%(+,-*!.-7-!0'%.-1!%31!7= +-,,-0-1!>8!&-3072<)4234! )<<-7!0.2&-A!9X/*0!+7/0/&/,*!2((-12%0-,8!+7/&--1!0/! 0'-!WFC!-G07%&02/3!%31!1/!3/0!&%,,!)0!1)-!0/!&-70%23!

PAGE 42

! "# $%&$'()*+,$-)!.!/+0!*1!%,$2'0-!*/%)!)*-34!!51&!+,!-632+,+ *%1,!17!*/%)!)*-3!)--! 833-,0%6!.. 94!! !"#"$"% &'(%)*+,-.+/01 % 51'&!/',0&-0! (%$&12%*-&)!17 !:;<:=<#!3/-,12>$/21&171&(>%)1+(?2!+2$1/12! @.889!A4B3C!)12'*%1,!D+)!+00-0!*1!*/-!3-22-*4!!E+(32-)!D-&-!F1&*-6-0!71&!;!)-$1,0)! +,0!)+*!71&!+,!/1'&!*1!+221D!3/+)-)!*1!)-3+&+*-!+*!&11(!*-(3-&+*'&-4!!G/-!+H'-1')! 2+?-&!@*13!2+?-&9!D+)!3%3-**-0!177 !+,0!32+$-0!%,*1!+!,-D!$2-+&!32+)*%$!#4;(I! $-,*&%7'J-!*'K-!D%*/!2%04!!8!)-$1,0!-6*&+$*%1,!D+)!01,-!1,!*/-!)+(32-)!K?!+00%,J! :BB'I!#B
PAGE 43

! "# $%&%! '()*%!+,!(%,-./!0 123(%!"45!!67(.+8(%9!:!'),.2+,%;!8&+<%&*!=>>?!=@=?!2,;!#AB!2,;! 67(.+8(%9!::!'), .2+,%;!8&+<%&*!=@#!2,;! =C#!0 123(%!"45!!67(.+8(%9!:!'),.2+,%;!=7D!)E! %2'/!E)&$2&;!2,;!&%F%&*%!8&+<%&!0G764?!#5G7D!HIJ!K7EE%&!=AL!0:,F+.&)-%,4?!=7D! 6-I( # !!0:,F+.&)-%,?!GA764?!=7D!;M1H!<+9!0:,F+.&)-%,?!G<6!%2'/4?!=7D!H(2.+,7
PAGE 44

! "" #$%&'()*+(!,-./01)$2(.3!45.0165783!957!:;!4?@957!>( A 0$.0B(>!C*1()@!! DE()'*%!F&F%0.2!C*+!F*))0(>!$51!$.!!,.*'(!$G!'*FE0.(8!C01E!*.!0.010*%!>(.*15)*10$.! +1(=!*1!H9IJ!G$)!9!'0.3!G$%%$C(>!K&!"9!F&F%(+!$G!H9IJ!G$)!L?!+3!9?IJ!G$)!L?!+3!MLIJ!G$)! "? +3!*.>!*!G0.*%!(N1(.+0$.!$G!9!'0.!*1!MLIJ@!! !"#"$"% &'(%)*+,-.*/-0*12 % :;+!C()(!/0+5*%0B(>!$.!LO!*2*)$+(!2(%+!C01E!*!L?!K*+(!=*0)!,K=8! %*>>()!,-./01)$2(.8!*.>!4PK=!%*>>()!=E$1$2)*=E(>!5.>()!QR!%02E1!5+0.2! S0$!-'*2( -.1(%%02(.1!T5*.10G0()@ ,U$)!*F15 *%!%*K!=)$1$F$%+!5+(>3!+((!<==(.>0N!--8 $"3%45+,.0+ % $"6% 718-.%9-:;.*2< % Q+0.2!%(++!0./*+0/(!1(FE.0V5(!$G!F$%%(F10.2!+*'=%(+!>(/(%$=(>!K&!<.>()+$.! *.>!W0%FE)0+1!,L??X8!>$(+!)(F$/()!:;(>!*!)(+5%1!1$!*.*%&B( @!!Z.%&!"9!$51!$G!1E(!Y9! +*'=%(+!)(+5%1(>!0.!(/0>(.F(!$G!:;.5%$ ? !J$%$.&!+*'=%(+ !CE0FE !&0(%>!:;!01+!F$))(+=$.>0.2!#J[! '5%10=%(N!15K( 3!:;3!$K+()/(>!=(%%(1!+0B(!>5)0.2! F$%%(F10$.!,*==)$N0'*1(!/$%5'(+!0.! \ 7!$G!=(%%(1!+0B(]!*8!/()&!+'*%%! ^ !?!1$!4?3!K8!+'*%%!44 A L?3!F8!+' A '(>!L4 A "?3!>8!'(>05'!"4 A Y?3!(8'(> A %2!Y4 A 9?3!*.>!G8!%*)2(! A !_9?83!*.>!C E()(!01!$)020.*1(>@ Collection Colony PCR Yielded Extract Label Size of pellet Number Label DNA (yes/no) Label (PBR#) at collection 1 M1C1 yes E1 803 small

PAGE 45

! "# M2C2 yes 2 M1C2 yes E2 806 small M2C2 yes 3 MIC3 yes E3 809 small M2C3 yes 4 M1C4 yes E4 508 medium M2C4 yes 5 M1C5 yes E5 510 sm med M2C5 yes 6 M1C6 yes E6 817 small M2C6 yes 7 M1C7 yes E7 821 medium M2C7 yes 8 M1C8 yes E8 824 medium M2C8 yes 9 M1C9 yes E9 826 small M2C9 yes 10 M1C10 yes E10 829 sm med M2C10 yes 11 M1C11 yes E11 832 medium M2C11 yes 12 M1C12 yes E12 835 very small M2C12 yes 13 M1C13 yes E13 838 med lg M2C13 yes 14 M1C14 yes E14 841 medium M2C14 yes 15 M1C15 yes E15 844 medium M2C15 yes 16 M1C16 yes E16 847 medium M2C16 yes 17 M1C17 yes E17 850 medium M2C17 yes 18 M1C18 yes E18 853 medium M2C18 yes 19 M1C19 yes E19 856 medium M2C19 yes

PAGE 46

! "# 20 M1C20 yes E20 859 medium M2C20 yes 21 M1C21 yes E21 861 medium M2C21 yes 22 M1C22 yes E22 864 med lg M2C22 yes 23 M1C23 yes E23 867 small M2C23 yes 24 M1C24 no E24 870 medium M2C24 no 25 M1C25 no E25 873 med lg M2C25 no 26 M1C26 no E26 876 med lg M2C26 no 27 M1C27 yes E27 879 sm med M2C27 yes 28 M1C28 no E28 882 medium M2C28 no 29 M1C29 no E29 885 medium M2C29 no 30 M1C30 no E30 888 sm med M2C30 no 31 M1C31 yes E31 891 sm med M2C31 yes 32 M1C32 yes E32 894 medium M2C32 yes 33 M1C33 yes E33 897 medium M2C33 yes 34 M1C34 yes E34 551 med lg M2C34 yes 35 M1C35 yes E35 553 med lg M2C35 yes 36 M1C36 yes E36 555 medium M2C36 Y es 37 M1C37 Yes E37 557 med lg M2C37 Yes 38 M1C38 Yes E38 559 med lg

PAGE 47

! "# M2C38 Yes 39 M1C39 Yes E39 561 small M2C39 Yes 40 M1C40 Yes E40 579 medium M2C40 yes 41 M1C41 no E41 574 medium M2C41 No 42 M1C42 No E42 577 large M2C42 No 43 M1C43 No E43 581 med lg M2C43 No 44 M1C44 Yes E44 584 medium M2C44 Yes 45 M1C45 Yes E45 587 medium M2C45 Yes "#$!%&'()*+,-..&,-!/0+.1*&* $%&'()*'!+,-.+/0+!(1! 2+0(,+2+.30(%%+0&+.! 45$!678! 92+8+/&!1(2 !:7/;! 87:9%+87/.8!)8-/*!7*72(8 +!*+% +%+0&2(9'(2+8-8!'7.!-/0(/0%)8-,+!2+8)%&8!1(2!8(:+!(1!&'+!87:9%+8?!!@/%;!AA!(1!&'+! 2+:7-/-/*!"B!0(%(/;!87:9%+8!;-+%.+.!>7/.-/*!&'7&!0()%.!>+!,-8)7%-=+.)&!"!0(%(/;! 87:9%+8!'7.! -/0(/0%)8-,+!2+8)%&8!1(2!C)%&-9%+D!A!ECAF!GHI!2+70&-(/!!EJ7>%+!BF? J(!>+!0(/8+2,7&-,+9F!6+2+!788-*/+.!1(2!,-8)7%-=+.! 45$!>7/.8L!MNO%+!BF?!!! Q7/.8!6+2+!788-*/+.!(/+! (1!&'+8+!%+/*&'8!(/%;!-1!&'+2 +!678!7!.-8&-/0&!>7/.!ER-*)2+! AO F!7/.!-&!1+%%!6-&'-/!&'+!07%0)%7&+.!27/*+!(1!%+/*&'!>;!S/&+%%-*+/&!T)7/&-1-+2U8!EQ-(!

PAGE 48

! "# $%&'(!)*+,(%+-!&.&/*+0+!,11/2!!34$.51.5/6+07(8!%(&.,!,9&,!&/,916'9!:;1+(!'(/!(/(5,>1?91>(+0+!@1>!51/1.0(+!# A BC2!!D0'9,!/&.(+! E(,F((.!,9(!/&GG (>+!&>(!@>1%!H6/,0?/(I!B!3HB-2!!J (@,!/&.(+!E(,F((.!/&GG(>+!&>(!@>1%!H6/,0?/(I!C! 3HC-2 !! K&.G+!/(++!,9&. !BLME?!F(>(!>('&>G(G!&+!&>,0@&5,+!1@!,9(!NOD!>(&5,01.!E&+(G!1.!'(/+!F0,9!.1! :; ,0@&5,+2!4Q8! R !.1!&%?/0@05&,01.S.1!?>(+(.5(!1@!%05>1+&,(//0,(! 351>>(+?1.G+!,1!4Q8!0.!T&E/(!U-2 !!! &%?/0@05&,01.!@>1%!NOD!1556>>(GP!,9(!E&.G+!F(>(!,11 !@&0.,!1>!,11 !,905V!&.G! 17(>/&??(G!C!1>!%1>(!1@!,9(!&++0'.(G!#!/(.',9+!%(.,01.(G !&E17(-2 (/&,(G.(++!%&,>0I!F&+!5>(&,(G!,1!@0.G!&.*!,>(.G+!&.G!,1!9(/?! 70+6&/0=(!,9(!>(+6/,+!6+0.'!51/1>+!,1!+91F!?>1E&E/(!>(/&,(G.(++!1@!(&59!+&%?/(G! 51/1.*!,1!,9(!>(+,!1@!,9(!+ &% ?/(G!?1?6/&,01.!3 W0'6>(!CB -2!! !T9(!%&,>0I!9&+ !,9(! &++6%?,01.!,9&,! ,9(!&??>1I0%&,(G!&%?/051.!/(.',9+!1@!,9(!+&%?/(+!&>(!+6@@050(.,!,1! +6E+,0,6,(!@1>! ,9(!&5,6&/!&%?/051.!+(X6(.5(+2!!T9(!51.+(X6(.5(!1@!,90+!51.+(>7&,07(!

PAGE 49

! "# !"#$%&'( !$%&%'(!)*+,&-)!./*.!(0-&1-1!*'*&(2*3&-!4-)5&.)!6%4!+074%)*.-&&0.-!*'*&()0)8*))09'+-'.!.-).! )/%: 0'9!:/07/!+5&.0,&-;!4-*7.0%'!0. !:*)!64%+ '%! *+,&0607*.0%'!64%+!./-!,40+-4
PAGE 50

! "# Colony 1 2 3 4 5 6 7 8 9 10 12 13 14 15 17 18 19 20 23 27 37 39 1 2 3 4 5 6 7 8 9 10 12 13 14 If 15 17 18 19 20 23 27 37 39 Legend: Match 5/5 loci Match 3/3 loci with 2 loci inconclusive Match 4/5 loci Match 2/3 loci with 2 loci inconclusive Match 3/5 loci Inconclusive Match 2/5 loci !"#$%&'() *' $%&%'(!)*&+,*-'*..!/+,)01!23*)*!*+43!4%&%'(!0.!506*'!+!7)%8+8&*!.,)*'5,3!%9!)*&+,*-'*.. ,%!*+43!4%&%'(!0'!.+/7&*-!7%7:&+,0%' !:'-*)!,3*!+..:/7,0%'!,3+,!+77)%10/+,*-!+/7&04%'!&*'5,3.!0.! .:99040*',!,%!.:8.,0,:,*! 9%)!+4,:+&!.*;:*'4*!%9!+/7& 04%' !<:.0'5!-+,+!9)%/!=+8&*!>? @!! +..:/7,0%'!0.!,3+,!+&,3%:53!+/7&04%'!&*'5,3.!/+(!8*!,3*!.+/*!,3*!+4,:+&!&*'5,3!%9! ,3*!/04)%.+,*&&0,*!20,30'!,3*!+/7&04%'. !<%9!.0/0&+)!&*'5,3?!4+'!8*!-099*)*',A!23043! 2%:&-!506*!:.!+!)*.:&,!%9!-099*)*',!5*'%,(7*@!!B:,!8(!+..:/0'5!,3+,!,3*(!+)*!,3*!

PAGE 51

! "# $%&'(!)*!&%+'$!)*!,%-.'-!*/!-'%0,!*,'!1233!,45/*,'$)$!*,%*!*,'!0/3/1)'$!%-'!1/*! -'3%*'.!*/!'%0,!/*,'-6!!7,2$(!%14!.)88'-'10'$!8/21 .!)1!*,'!&)0-/$%*'33)*'!%1%34$)$!%3$/! 9'0/&'!&/-'!$):1)8)0%1*6!!;/ /+)1:!%*!*,'!&%*-)):2-'!?@ A(!&/-'!1/1 B -'.!$C2%-'$! /D'-!-'.!$C2%-'$!.'1/*'!%!,):,'-!:'1'*)0!.)D'-$)*4(!*,2$!,):,'-!5/523%*)/1! 0/11'0*)D)*46 "#$!%&'()''&*+ 7,)$!$*2.4!%**'&5*$!*,'!./02& '1*%*)/1!/8!%!$5'0)8)0!$)*'! E !F3%1*%*)/1!G'%0,! H'$/-*!I/D'! E !%1.!%$!%!C2)0+!J3)*&2$!*'$*K!8/!5/523%*)/1!0/11'0* )D)*4!8/-! !"#$%&'%(% 6!! L*!M%$!%!N B 5%-* !5-/0'$$!/8O!!=@A!0-'%*)1:!$5%*)%3!&%5$(!=?A!0/33'0*)1:!$%&53'$!%1.! 0-'%*)1:!*,'!5-/*/0/3!8/-!*,'!3%9!'<5' -)&'1*$(!%1.!=NA!:%)1)1:!%!:3)&5$'!/8!*,'!$29 B 5/523%*)/1!$*-20*2-'!/8! !"#$%&'%(% !%*!*,)$!$)*'!*,-/2:,!%1%34$)$!/8!*,'!.%*%6 "#,!-&./0!1+0!213!4.56*0*/*7&.' P%5$!%-'!)1,'-'1*34!)&5/-*%1*!8/-!5/523%*)/1!0/11'0*)D)*4!$*2.)'$!9'0%2$'!)*! :)D'$!4/2!*,'!$5%*)%3!. )&'1$)/1!/8!4/2-!8)'3.!$)*'!%1.!%33/M $ !4/2!*/!:/!9%0+!*/!4/2-! $%&53'.!)1.)D).2%3$!=$'$$)3'!/-:%1)$&$A!8/-!82-*,'-!$%&53)1:!%1.Q/-!/9$'-D%*)/16!! R3*,/2:,!*,'!*'0,1)C2'$!L!2$'.!*/!0-'%*'!&4!&%5$!M''!$)&53'!%1.!-2.)&'1*%-4(! *,'4!M' -'!$288)0)'1*!8/-!*,'!52-5/ $'$!/8!*,)$!$*2.4!%1.!0%1!9'!2$'823!8/-!82*2-'! $*2.)'$ !%$!M'33 6!!7,'-'!%-'!1'M'-!*'0,1/3/:)'$!8/-!&%5 B &%+)1:!%D%)3%93'6!!SFT!21)*$! 8/-!&%-)1'!2$'!,%D'!9'0/&'!$&%33'-!%1.!3'$$!'<5 '1$)D'(!92*!0%1!$*)33!9'!0/$* B 5-/ ,)9)*)D'!8/-!$&%33!821.'.!5-/U'0*$6! 7,'!0/33 '0*)/1!/8!0/-%3!$%&53'$!M%$!$200'$$823!8/-!*,)$!$*2.46!!7,'!2$'!/8! HVR3%*'-!=R&9)/1A!5-/D'.!*/!9'!%1!'88'0*)D'!5-'$'-D%*)D'!8/-!9/*,!WVR! =*,)$!$*2.4A!

PAGE 52

! "# $%&!'()!*)%&+,-.%!$%&!/0123,0-4!566789!!:;!-$<=1+-!>+,+!#?!<.%43-!.1&!$%&! $143.@A3!B!3$&!4.!0%21@&+ !$%!+C4 ,$!-4+=!.D!>$-30%A !-$14! 2,;-4$110E$40.% !.F+,!40<+ G!B! >$-!-4011!$H1+!4.!+C4,$24!+%.@A3!I()!D.,!<02, .-$4+1104+!$%$1;-0-9! J .<+!.D!43+!.,A$%02!<$44+,!0%!-.<+!.D!43+!-$<=1+-!>.@1&!%.4!=+11+4!+F+%! $D4+,!$&&040.%$1!2+%4,0D@A$40.%!$%&!$4!2..1+,!4+<=+,$4@,+-!*"! $%&!5"&+A,++-89!!B! -@-=+24+&!43$4!43+!=$,4021+-!43$4!>.@1&!%.4!=+11+4!>+,+!-$4@,$4+&!>043!43+! =,+ -+,F0%A!-.1@40.%!*-$<=1+-!>+,+!#!#K5 !;+$,-!.1&8!43$4!04!3$&!$1<.-4!43+!-$<+! &+%-04;9!!B!=0=+44+& !.DD!$-!<@23!-.1@40.%!=.--0H1+!$%&!$&&+&!#6L69#!MN O H@DD+,!4.! 23$%A+!43+!&+%-04;!.D!43+!-.1@40.%9!!J$<=1+-!>+,+!F.,4+C+&!$%&!$11!.,A$%02!<$44+,! =+11+4+&9!!)1-.G!0%040 $1!+C=+,0<+%4$40.% !.D!43+!+C4,$240.%!4+23%0P@+!-3.>+&!43$4!43+! '()1$4+,!*) .@1&!=,.&@2+!-$14!2,;-4$1-!>043!43+!$&&040.%!.D!+43$%.1! *+043+,!?6 O #66Q8!.,!43+!-$<=1+-!3$&!2,;-4$1-!$1,+$&;!=,+-+%49!!M3+!-.1@40.% !4.!430! >$-!4.! =+11+4!43+!.,A$%02!<$44+,!$%&!-$14-!H;!2+%4,0D@A$40.%G!=0=+44+!.DD!$-!<@23! -.1@40.%G! >$-3!43+!0%040$1!-$<=1+!>043!#6L69#!MN O H@DD+,!4.!&0--.1F+!43+!+C2+--!-$14-G! $%&!,+ O 2+%4,0D@A$40.%!4.!=+11+4!43+!.,A$%02!<$44+, 9 !"#"#$ %&'()*$+,-$./*)01 $ : ;!;0+1&!.D!$%$1;E$H1+!I()!>$-!"797RQ!*55!.@4!.D!"S !2.1.%0+-89!!B 4 !A$F+!$! T-%$=!-3.4U!.D!43+!A+%+402!F$,0$H0104;!.D!43+!-$<=1+& !=.=@1$40.% !* V0A@,+558 9!!)%&! -=+20D02!4.!430-!-4@&;G!#7!.@4!.D!43+!4.4$1!56!2.1.%0+-!D.@%&!.%!43+!TW+D4!X.,$1!Y$423U! 0%!43+!YZ'!-04+!>+,+!$%$1;E$H1+G!A0F0%A!$!;0+1&!.D!R6Q9!!*[%1;!2.1.%0+-!##!$%&!#\! >+,+!0%2.%21@-0F+!D,.043 !1$H!4+23%0P@+-9 !!V.,!+C$<=1+G! 0%!43+!H+A0%%0%A!.D!

PAGE 53

! "# $%&'()*+!$,&!-&$,./01! $,&2&!%&2&!)*0$'*3&0!%,&*!0'-45&0!%&2&!$'(&*!. 6$!$.!$,'%1! 76$!0'$!8.2!,.620! .*59!$.!7&!2& : 82.;&*)*+!6*&>4&3$&/! 42.75&-0!%,)5&!$29)*+!$.!42.3&00!$,&!0'-45&0!EEF!$ ,'$!)-42.A&/!.A&2!$)-& !3'*!7&!60&/! 79!.$,&2!0$6/&*$0! '*/!%.65/!0,.2$&*!$,&)2!5'7!$)-&!3.-4'2&/!$.!-)*& )-'$&59!"!-.*$,0!8.2!-&!$.! 42.3&00!-9!0'-45&0 '-45&0 !'2&!5&'2*)*+!$,'$!$,&!4.%&2!064459!8.2!$,&! &5&3$2.4,.2&0)0!3.65/!7&!0&$!'$!J"KL!'0!3.-4'2&/!$.!$,&!)*)$)'5!'$$&-4$0!'$!MKL$2'3$)*+!'*/! 462)89)*+!B?C!8.2!#K!0'-45&01!%&*$!/.%*!$.!'*!'8$&2*..*!8.2!&'3,!-65$)45&>! 2&'3$).*
PAGE 54

! "# !"#"$% &'()*+,-'+*.*/*.0%12 3.4536*) % $%&'()!*'+!,%)(-(.(-/!*-&!0(12,!*'+!+*'3&-(456!740!0%&8!*-&!2'&19&'52:&! *'+!;2+&)8!*:*2)*7)&!&:&'!2'!+&:&)(92'3!,(4'0-2&5!2'!0%&!0-(92,5205! *:*2)*7)&!.-(/!3&'&02,!-&5&*-,%!9-(+4,0!,(/9*'2&5!0%*0!&10-*,0!?@A205! ;(4)+!*)5(!-&+4,&!0%&!'4/7&-!(.!50&95!*'+!)&55!0;&*>2'3!(.!0%&!/&0%(+56!740!0%&8! ,*'!7&!&19&'52:&2'3! 0%&!-&*3&'05!/85&). !;*5 !7*5&+!('!,(50!*'+!*,,&55272)208&!/2,-(5*0&))20&5!*-&! ; %*0!8(4!;*'0!0(!*/9)2.86!*'+!%*:&!9-2/&-5!+&:&)(9&+!.(-!0%&/! *+:*'0*3&! (.!9-&:2(45!;(->!78!K*4/5!*'+!,())&*34&5 !LMDDEN!;%(!,-&*0&+!0%&! 3&'(/2,!)27-*-8!.(-! !"# $%&'%(% 6!.(4'+!0%&!/2, -(5*0&)) 20&56!*'+!+&:&)(9&+!0%&! 9-2/&-5 &!92/&-!+2/&-5!*'+!*-02.*,05N!*'+ !)&55&'&+ !,(505!(.! '(0! +&523'2'3!*'+!94-,%*52'3!-&9(-0&-!+8&5!0%*0!0*-3&0!0%&!59&,2.2,!*/9)2,('5 ( 40;&23%&+!0%&!+&,252('!0(!45&!O P $HI6!*!+2..&-&',&!(.!*0!)&*50!QCDD!9&-!9-2/&-
PAGE 55

! "" #$!%& !'()%*(+!,#+-!./0*(!123 !$#(!#4*(!2333!( *5,-)#/+!.+)/6!-7*!'(#-#,#8!9! 0*4*8#'*0: !;7*!.+.58!'(#-#,#8!$#(!-7)+!-&'*!#$!+-.0&!)+!-#!+*<.*/,*!-7*!5%'8),#/+ !5+! =*88!-#!<.5/-)$&!-7*!%),(#+5-*88)-*+!#$!-7*!)/0)4)0.58!#(65/)+% :!!;7*!>.8-)'8*?!@AB!)/! -7)+!+-.0&!=5+!*$$*,-)4*!)/!&)*80)/6!5%'8),#/+C!=7),7! ,#.80!D*!+*<.*/,*0!$#(!$.(-7*(! 5/58&+)+: !"#$%&'()*+,&-$.&--/0+,1,+2$*-*)23,3 $ E+!%*/-)#/*0!*5(8)*(C!-7*!D*+-!/*?-!+-*'!#$!-7)+!+-.0& !)+!-#!+*<.*/,*!-7*! 5%'8),#/+!$#(!5!D*--*(!<.5/-)$),5-)#/!#$!-7*!%),(#+5-*88)-*!5/58&+)+: !!F*,5.+* !-75-! =5+!85,G)/6 C!9!750 !-#!.+* !,#/+*(45-)4*!5++.%'-)#/+!)/!5++)6/)/6!%),(#+5-*88)-*! )0*/-)$),5-)#/!$#(!*5,7 !)/0)4)0.58!)/!-7*!+.D H '#'.85-)#/ :!!;7)+ !%50*!,#/,8.0)/6!-7*! /.88!7&'#-7*+)+!#$!754)/6!6*/*-),!45()5D)8)-&!D*-=**/!I!#(65/)+%+ !75(0*(!-#!(*5,7:!! J*+')-*!-7*!,#/+*(45-)4*!5++.%'-)#/+C!=*!,#.80!+**!5!0)4*(+)-&!#$!6*/*-),!%5G*.'! ,#%*!#.-!#$!-7*!05-5:!! !"#"4$ .&)&-2$5/)*+/6-/33$7*+8,9 $ ;7*!,#8#/&!(*85-*0/*++!%5-()?!KL)6.(*!I2M!6)4*+ !.+!5/!)0*5!#$!-7)+!0)4*(+)-&!#$! -7*!+5%'8*0!'#'.85-)#/ :!!A#/+)0*(!-7*!=#!*?-(*%*!,5+*+:!!9$!-7*!%5-()?!=5+!588!(*0C! -7*/!-75-!=#.80!'#)/-!#.-!-75-!588!-7*!+5%'8* 0!,#8#/)*+!=*(* !#$!-7*!+5%*!6*/*-! N !-7*! '#'.85-)#/!6(*=!$(#%!5+*?.58!(*'(#0.,-)#/!-7(#.67!$(56%*/-5-)#/ N '#'.85-)#/! ,#//*,-)4)-&!)+!,#%'8*-*8&!,8#+*0: !!;7)+!)+!/#-! ./7*5(0!#$ :!!F5.%+!5/0!,#88*56.*+! KI33OM!)/!-7*)(!)/)-)58!*?'*()%*/-+!$#./0!)/!-=#!+*'5(5-*!L8#()05!,#(58!(**$+ KP(*,)5/!(**$!5/0!Q#(+*+7#*!(**$MC! !"#$%&'%(% !+-5/0+!#,,.'&)/6!5!(50).+!#$!2O! %*-*(+!D*)/6!-7*!+5%*!6*/*-:!!R#,58!'#'.85-)#/!6(#=-7!-7(#.67!+*8$ H $*(-)8)S5-)#/!5/0! 8#,58!(*,(.)-%*/-!)+!(.8*0!#.-!D&!#D+*(45-)#/+!-75-!E,(#'#()0+!5(*!'##(!+*8$ H

PAGE 56

! "# $ %&'()(*%&+!,-./01(!%'!0)2!344562!!78(+!90+!$.&'8%&!+.::;&'%;='&;))%;1:0&%&;++ ? $%&'()(*%(!10'>8%+6!%@> %:'!$;&!'8%!<(0A;=0)!&%0)!:;:.)0'(;=+! H !'8%!:;:.)0'(;=! >;==%>'(D('B!(+!>;1:)%'%)B!;:%=!,0=&.('1%='!80>.&&%<62!!G%'9%%=!'8%+%!'9;!%@'&%1%+!B;.!9())!80D%!0))!'8%!:;++(F)%!>;);&! >;1F(=0'(;=+!(= !'8%!F;@%+2!!!78%&%!9())!F%!0!=. 1F%&!;$!F;@%+!&%8!(+!A;;< !(=! '8%!+%=+%!'80'! ($! '8%!>;&0)+ I !<%+:('%!FB!+;1%!:8B+(>0)!$;&>% F%>;1%!$&0A1%='%;.);1:)%'%)B!=%9!A%=%'!90+! &%>&.( '%;);&+! H !&%)0'%;);=(%+!80D%!&%0>8%'(D%!>;==%>'(D('BI!0&%! >&;++ ? $%&'()(*(=AI!0=&.('1%='2!!J%)$ ? &%>&.('1%='!(=!('+%)$!(+! (1:;&'0='!';!'8%!);>0)!:;:.)0'(;=!F%>0.+%!:%&+(+'%=>%!(+!0)+;!0!+(A=!;$!0!8%0)'8B!);>0)! :;:.)0'(;=2!!! 70F) %!L!F%);9!10/%+!.+%!;$!10'&(@!,-(A.&%!3C6 !FB!>;.='(=A!'8%!=.1F%&! ;$!%0>8!>;);&%;);=B!&%)0'(;=+ !';!0))!;'8%&!>;);=(%+ 2 78(+!'0F)%!+8;9+!'80'!(=!'8(+!+'.;&0)+! >0=!&% ? %+'0F)(+8!'8%1+%)D%+!0='(;=!;>>.&&(=A!;=!'8(+! &%%$!:0'>8!0=&.('1%='2 !

PAGE 57

! "# "#$%&'( !$%&'(!%)!*+%,-,./!+/.-(/0'/11!2%'1(+&2(/0!)+%3!(4/!$%.%'5!6/.-(/0'/11!7-(+89!:;8<&+/!==>! :<+//'!-'0!08-<%'-.!,%9/1 !)+%3!(4/!3-(+89 ?/+/!8<'%+/0 >@ ! A+%,-,.5 6/.-(/0! B8))/+/'( ! C-3/ ,&(!'%( !1-3/ D/'%(5*/ ! D/'%(5*/ D/'%(5*/ 6/0! 1E&-+/ 1 !:FGF!.%28!3-(24> HI= J+-' ! HH= D%.0!1E&-+/ 1 !:KGF!.%28!3-(24> ! LI M/..%?!1E&-+/ 1 !:=GF!.%28!3-(24> ! FN O48(/!1E&-+/ 1 !:'%!.%28!3-(24> ! I A/+2/'(-@ !!Y&(!&18'
PAGE 58

! "# $%&'!()&!)&*($&+,! !-**!)&*($&+!./!011+!.2!$%&!/&2/&!$%($!$%&)&!./!3122&3$.4.$'!5&$6&&2! $%&!/.$&/!17!89:!12!;('1!<('1)!(2+!=1/>.$(*!12!;('1!<&21) !?31*12'!@#!(2+!@AB! C(5*&!#DB!(!+./$(23&!17!(>>)1E.F($&*'!G,H!I.*1F &$&)/!?J.0K)&!G@D ,!!L2!3124&)/($.12! 6.$%!$%&!*13(*/B!$%&)&!&E./$/!(!/$)120!/K)7(3& !3K))&2$!5&$6&&2!$%&!$61!./*(2+/ !(2+! $%&)&!(*/1!& E./$/!(!$)&23%!?J.0K)&!G@D,!!9K$!+&/>.$&!$%($!*()4(&!6&)&!(5*&!$1!3)1//,!! M271)$K2($&*'B!$%. /!/$K+'!3(221$!+.77&)&2$.($&!6%.3 % !6(/!$%&!/1K)3&!1)! 6%.3% !6(/! $%&!/.2I!1)!51$%!&E>1)$!$1!&(3%!1$%&),! L7!$%&)&!6(/!F1)&!/(F>*.20!17!51$%!/.$&/!6.$%! /&NK&23.20!17!$%&!(F>*.7.&+!F.3)1/($&**.$&/B!.$!./!>1//.5*&!$1!3(*3K*($&!$%&! >)15(5.*.$.&/!17!/1K)3&!(2+!/.2I!?<(2&*!OPPHDB!5K$!.$!31K*+!(*/ 1!/%16!$%($!$%&!$61! /.$&/!()&!(3$K(**'!21$!3122&3$&+,! M/.20!C(5*&!#!6&!3(2!$(I&!J.0K)&!GQ!17!$%&!F(>>&+!+./$(23&/!17!31*12.&/!G!$1! OP!12!$%&!R&7$!;1)(*!8($3%!(2+!31*1)!31+&!&(3%!0&21$'>&!(/!(!)&>)&/&2$($.12!17!$%&! 0&21$'>.3!4().($. 12!12!$%($!)&&7!>($3%!?J .0K)&!OO D, Number of Primer Primer Primer Primer Primer Genotypes 181 (bp) 166 (bp) 207 (bp) 182 (bp) 192 (bp) Colonies 1 140 160 X 160 260 1, 2, 3, 9, 10, 13, 14, 15, 39 2 140 160 170 160 260 4, 5, 6, 7, 23 3 140 160 X 160 X 8 4 140 160 170 X X 12 5 140 160 170 160 180 18 6 140 160 170 150 260 27 7 140 160 X 150 X 37 !"#$%&'( !S&21$'>&/!.+&2$.7.&+!5'!K2.NK&!31F5.2($.12/!17!(//.02&+!*&20$%/!17!5(2+/,!-**!31*12.&/!()&! 7)1F!89:B!&E3&>$!@#!(2+!@A!?.2!51*+DB!6%.3%!()&!7)1F!=1/>.$(*!/.$&,!!C%&!@!31*12.&/!21$!.23*K+&+!.2! $%./!$(5*&!()&!G#B!GAB!(2+!OP!6%.3%!%(+!12&!FK*$.>*&E!)&(3$.12!5 &!.23123*K/.4&, !?T! U !21!(F>*.7.&+!VW-! 7)1F!$%($!>).F&)D,

PAGE 59

! "# $%&'()!** !+,)-!-.,/!0.)!)12)30)+!34'-0)(%5&!,6!0.)!(78)0!+')!0,! 6(7&8)5070%,5 9!!:0!74-,!-.,/-!0.70!)73.!&)5)0!34'-0)(!-))8! 0,!-2()7+!%5!7!4%5)!0.70! 6,44,/-!0%+74!/7;)!3'(()50-!,6!0,!75+!6(,8!0.)!-.,()9!! <.)()!7()!=!,0.)(!&)5)0-! >&)5,0?2)!= @ AB!<7C4)!DE!5)-04)+!C)0/))5!0/,!+,8%5750!&)5)0-!>&)5,0?2)!F!75+!*B! <7C4)!DE B!C'0!744!&)5)0-!7()!()470)+!0,!)73.!,0.)( !-'22,(0%5&!-)1'74!()2 (,+'30%,5!75+! -)46 @ ()3(' %08)509!!$%&'()!** !()2()-)50-! 7!3,(74!-075+!/%0.!7!(7+%'-!,6!FG!8)0)(-B !"#$%&'(( ) !H)2()-)5070%,5!,6!A!&)5,0?2)-!2()-)50!,5!I)60!J,(74!K703.!%5!KLH!J,;)9!!M07(-!/%0.!3,4,(-! C4')B!&())5B!()+B!2'(24)B!75+!,(75&)!()2()-)50!)73.!+%66) ()50!&)5,0?2)!>,(75&)!+%78,5+-!()2()-)50! 3,4,5%)-!/%0.!'5()-,4;)+!&)5,0?2)-E9 /.)()!0.)()!7()!70!4)7-0!A!&)5)0-!,'0!,6!*N!3,4,5%)-! O !*AP!,6!0.%-!2,2'470%,5!%-! &)5)0%3744?!+%;)(-)9! Q40.,'&.!0.%-!4,,R-!2(,8%-%5&B!%0!+,)-!5,0!&%;)!'-!0.)!6'44!2%30'()!?)09! !S,)-! *AP!&)5)0%3!+%;)(-%0?!,6!0.%-!3,(74!2703.!8)75!7!.)740.?!2703.!,(!5,0! O %5 0)(8-!,6! 2 ,2'470%,5!3,55)30%;%0?T!!U)!375 5,0!-7?!70!0.%-!8,8)50!'50%4!8,()!-%0)-!,6!-'C @ 2,2'470%,5-!7()!-7824)+!75+!,C-)(;)+!0,!2)(-%-0!,(!5,0!75+!0.)!3'8'470%;)!+707!

PAGE 60

! "# $%&'()*+ ,-+!,-,)./*+!0%1)+!234!&*,-! 56*,)76.8!%9!-%7 !,:%17!76(;!;'*$(<($!;(7*=!! >17!,7!)*,;7!76(;!;(7*!6,;!,!-1&:*9!76,7!$,-!:*!,++*+!7%!<1719*!+,7,!,-+!$%&',9*+!7%! %76*9!;(7*;=! ?6*!,++(7(%-!%
PAGE 61

! "# $%&'( !' )* !%+*,-..!$%&'!%/!')0&!&'123!4-& !152*,!67(###8! !9%,*!')-5!"## !&-:;.*&!$%1.2! )-+*!<**5!;,%$*&&*2!/%,!')*!&-:*!;,0$*(!$%:;-,*2!'%!7#"!05!')0&!&'123( 40')!')*! =5%4.*2>*!%/!)%4!:1$)!%/!*-$)!,*->*5'!4-&!-$'1-..3!1&*2!/%,!;,%$*&&05>(!-2?1&'05>! ')*!;1,$)-&*!%,2*,! '%!,*/.*$'!')-'(!-52!40')!.-!:%,*!;,*$0&*!-52! *//0$0*5'8!!A/!-!/0*.2!*B;*,0:*5'!2*&0>5*2!'%!>*'!C!&-:;.*&!;*,!$%.%53!/ %,!D"!$ %.%50*&! ;*,!&0'*(!')*5!-,%152!E &0'*&!$%1.2!)-+*!<**5!&-:;.*2!-52!$%:;-,*2!0::*20-'*.38! !"#$ %&'(()*++*($,')-'./*+ $ !"#"0$ 1*&*2-3$45+'-3-+6$'&($78-6*)-+6 $ F%,-.!$ %.%50*&!-,*!<-&0$-..3!',*-'*2 !-&!%5*!%,>-50&:!40')! -!>*5*'0$! 150@1*5*&&!&)-,*2!<3!-..!0'&!$.%5*&8!!G3;0$-..3(!4*!-&&1:*!')-'!-..!;%.3;&!')-'!-,*! $%55*$'*2!%5!-!$%5'0>1%1&!&1,/-$* !%/!')*!$%.%53!-,*!$.%5*&!%/!') *!%,0>05-.!&*B1-..3! ,*;,%21$*2!.-,+-!')-'!*&'-<.0&)*2!')*!$%.%538!!H1'!&%:*!%/!')*&*!$%.%50*&!$-5!<*! %+*,!7###!3*-,&!%.28!!A&!0'!;%&&0<.*!')-'!')*,*!4-&!-!&%:-'0$!:1'-'0%5!05!%5*!;%.3;(! &1,+0+*2!-52!-&*B1-..3!,*;,%21$*2!-&!')*!$%.%53!>,*4I! H122*:*0*,!-52! $ %..*->1*&! J7KKLM!05/*,,*2!')-'!-!$%.%53!7##!3*-,&!%.2!$%1.2!*-&0.3!)-+*!%+*,!7#(###!;%.3;&! 40')!C!&1$$*&&0+*!:1'-'0%5&!1&05>!:%2*.&!')-'!$-.$1.-'*2!;%.3;!>,%4')(!&0N*(! ,*;,%21$'0%5(!$%.%53!->*!-52!&0N*(!'0:*!%/!&%:-'0$!:1'-'0%5!-52!-&&1:;'0%5&!%/! 5%5 O ,*?* $'0%5!%/!')*!$%.%53!%/!')*!:1'-'*2!;%.3;!40')!$-;-<0.0'3!'%!-&*B1-..3! ,*;,%21$*!-52!:1'-'0%5!,-'*&!%/!-!)*:0&;)*,0$-.!$%,-.!$%.%538!!G)*3!:-2*!')*&*! $-.$1.-'0%5&!-&!;,%<-<.*!&',-'*>0*&!%/!&$.*,-$'050-5!$%,-.&!'% P J7M! -$$.0:-'*!'%! $) -5>05>!*5+0,%5:*5'-.Q;)3 &0$-.!/-$'%,&!J0*8!'*:;*,-'1,*!$)-5>*&!%,! -5'),%;%>*50$ -..3 !$-1&*2M!'%!')*!20//*,*5$*&!%/!')*!:0$,%*5+0,%5:*5'!%/!')*!<-&*(! 152*,&02*(!*B'*52*2!%,!*B;%&*2!'%!&15.0>)'!;-,'&!%/!')*!$%.%53(!%,!JDM!-2-;'!'%!

PAGE 62

! "# $%&'()'(*+,!%,-!+.),/!'0!1,%,0$&$*2!3''4*%+5,22*,!+5 ('675!+5,/,!86+*+,9!)'2.)/ !'(! '+5,(!+.),!'0!1,%,0$&$*2!86+*+$'% : !! ;2+5'675!7,%,+$&!8'/*$&$/8!$/!%'+!.,+! 9'&68,%+,9!0'(!&'(*2/!$+! 9',/ !'&&6(!$%!)2*%+/!<=5$+5*8!*%9!>2'1'9&5$?'00!#@A#B! *%9!'+5,(!&2'%*2!'(7*%$/8/ !*%+,2$&,/!#@@@B:!!H%!*!/+69.!'0!+-'!9$00,(,%+!)')62*+$'%/!'0! !"#$%$#&'()**+%$#& !$%! +5,!C(,*+!I*(($,(!J,,0K!+5,(,!-*/!*!LM!*%9!"M!&5$8,($/8!0'6%9!+5,!/61 N )')62*+$'%! +,)5*%!,+!*2:!LPP@B:!!H%! +5,!/*8,!/+69.K!+5,.!0'6%9!+5*+!+5,!&5$8,(*/! &'%/$/+,9!'0!5$752.!(,2*+,9!16+!7,%,+$&*22.!9$00,(,%+!)'2.)/K!/677,/+$%7!+5*+!+5,! *22'(,/)'%/,!/./+,8!'&&*/$'%*22.! *22'-,9!06/$'%!'0!5$752.!(,2*+,9!&2'%*2!'(7*%$/8/! '0!+5,!/*8,!/),&$,/: H!$%&269,!+5,/,!)5,%'8,% *!$%!+5,!9$/&6//$'%!1,&*6/,!+5$/!&*%!*00,&+!+5,! (,/62+/!'0!+5$/!/+69.!$0!$+!'&&6((,9!$%!+5,!&'2'%$,/!/*8)2,9:!!Q%2.! '%,!/*8)2,!0('8! ,*&5!&'2'%.!-*/ !*%*2.3,9!0'(!+5$/!/+69.:!!H0!*!&'2'%.!/*8)2,9!5*9!8'(,!+5*%!#!7,%,+K! +5,%!+5,!(,/62+/!*(,!6%9,((,)(,/,%+,9:! !E5,(,!&'629!5*F,!1,,%!7,%,+$&*22.!9$00,(,%+! )'2.)/!'%!+5,!'+5,(!/$9,!'0!*!&'2'%.!/*8)2,9!+5*+!-*/!+5'675+!+'!1,!$9,%+$&*2!+'!*! %,$751'($%7!&'2'%.!96,!+'!0(*78,%+*+$'%!<+5,!/$9,!/*8)2,9!9$9!&'8,!0('8! 0(*78,%+*+$'%!'0!+5,!&'2'%.!1,/$9,!$+K!16+!06/,9!+'!*!5$ 752.!(,2*+,9!16+!7,%,+$&*22.! 9$00,(,%+!&'2'%.!'%!$+/!'+5,(!/$9,B:!

PAGE 63

! "# !"#"$% &'()*%+,-./01.,%2'13%*4+-5)6/ % $%&'!'()*+!,-'!).-/01!(2!*23)41.(!50)&*!.1-6'%261!502,!*+.-4&3'!-(!(%1!'&(1 -.*!&.(165-31'!76231''1'!/1(,11.!'%105!-.*!231-.&3!3)661.(' 8!!9!0-3:1*!(%1! :.2,01*;11!(%&'! &4726(-.(!-'713(!25!7%+'&3-0!-'713(!25!727)0-(&2.!32..13(&>&(+8!! ?'!41.(&2.1*! 1-60&16!.1-6'%261!50)&*!*+.-4&3'!-61!6132;.&@1*!-'!&4726(-.(!&.!0-6>-0!*&'716'-0!-.*! (13%.202;&1'!%>1!/11.!*1> 10271*!(2!'()*+!(%&'8!!A3-.'!(%-(!*&55161.(&-(1!*&55161.(! (14716-()61'!25!(%1!,-(16!320)4.!3-.!61>1-0!(%1!716&2*&3!&.(16.-0!,->1'!-.*!/261'! BC&.1*-!DEEEF8!!$%1!)'1!25!%&;%!561G)1.3+!6-*-61!3)661.('!2 .!(%1!41'2'3-01 < !5&.*&.;!1**&1'!-.*!-02.;!'%261! 3)661.('!BHIJ?K!L9.(16.1(ML)7*-(1*!#NN"MF8 !!$%161!&'!-0'2!(%1!O)6271-.!A7-31! ?;1.3+P'!Q6->&(+!5&10*!-.*!'(1-*+ R '(-(1!I31-.!H&63)0-(&2.!O=702616!BQIHOF!'-(100&(1! 0-).3%1*!&.!S-63%!#NNE! (%-(! 4-:1'!)'1!25!(%1!16(%P'!;6->&(+!5&10*! -.*!*&55161.31'!25! *1.'&(&1'!5624 !(272;6-7%&3 -0 *&55161.31' !(2!3-03)0-(1!(%1!-''23&-(1*!;12&*!'%-71! 32)701*!,&(%!&.5264-(&2.!25!-0(&41(6+!25!231-.!')65-31'!*)1!(2!52631'!0&:1!,&.* < !;&>1! /1((16!).*16'(-.*&.;!25!')65-31! 231-.&3!3)661.('!B OA?!L9.(16.1(ML)7*-(1*!#NDNMF8 % % % % % % % % % % % % % %

PAGE 64

! "# !"#$%%"&'()*$&+ $%%&'(!)*+!,)+-!./!,+01+'2&'(!)*+! 34-5&2.',!/6.4 !)*+!715)&-5+8!9:;! 6+32)&.' !<.15%!&'26+3,+!)*+!013')&)3)&=+!=351+!./!)*&,!,)1%>?!! $!,)1%>!./!,34-5+! %+(63%3)&.'!=+6,1,!*.!3/)+6!366&=35!/6.4!)*+!,&)+!3'%!3)!.)*+6! &')+6=35,!3'%!2.4-36&'(!)*+!BC$!>&+5%,D? $%%&)&.'35!43--&'( !3'%!,34-5&'( !./!355! !"#$%&'%(%# 2.5.'&+,!.'!9E;!:.=+!,&)+! 3'%!63%&3)+!.1)!).! +=+')1355>!+'2.4-3,,!)*+!<*.5+!79$ 23'!@+!32*&+=+%!3'%!,*.15%! @+!-16,1+%? F*+!3%%&)&.'35!&'/.643)&.'!./!(+'+)&2!&%+')&)&+,!./! !"#$%&'%(% !(3&'+%!&'!)*&,! )>-+!./!,)1%>!23'!@+!1,+%!3,!3'.)*+6!=36&3@5+!).!2.',&%+6!&'!(+'+!+8-6+,,&.'!,)1%&+,?!! $'!3%%&)&.'35!= 36&3@5+!).!&%+')&/>!&'%&=&%135,!&'!3!,34-5+!23'!-6.=+!).!@+!@+'+/&2&35?!! G.6!+834-5+H!&/!3!,34-5&'(!./!%&,+ 3,+%!3'%!'.' I %&,+3,+%!2.635,!<3, !43%+!3'%! J'.<5+%(+!./!<*&2*!2.5.'&+,!*3=+!1'&01+!(+'.)>-+,!3'%!<*&2*!2.5.'&+,!36+! 25.'+,H! -+6*3-,!&)!2.15%!'366.!%+2&%&'(!<*&2*!2.5.'&+,!<.15%!@+!4.6+! 3%=3')3(+.1,!).!,34-5+!).!/&'%!)*+!(+'+)&2!+8-6+,,&.'!<*&2*!2.15%!*+5-!355!2.5.'&+,? $,,&('4+')!)+,),!36+!-6.@3@5>!(.&'(!).!@+!3!,)3'%36%!-6.2+%16+!&'! -.-153)&.'!2.''+2)&=&)>!,)1%&+,!3,!)*+!2.,)!/.6!)* +,+!)>-+,!./!)+,),!36+!@+2.4&'(!5+,,! +8-+',&=+?!F*1,!&)!2.15%!@+!@+'+/&2&35!/.6!/1)16+!,)1%+'),!).!&'251%+!)*&,!)>-+!./! ,)1%>H!<*&2*!23'!@+!%.'+!63)*+6!01&2J5>!3'%!3,!3'!&%+')&/&23)&.'!)..5!./!)*+!,34-5+%! -.-153)&.',?

PAGE 65

! "# $%!&%'()%*!%)!(+,(!-%)!.%,,/0*+!&1/2+ )/,2!%)!3+'+(/&!2%,4/&/,25!+4&1!&%*%'6! 14,!(%!0+!,()4(+3/&4**6!,42.*+7!8/+9! ,42.*/'3!04,+5!-:)(1+,(!+;(+',/%',5!4'7!7/--+)+'(! ,/7+,0,+)?4(/%'!4'7!7%&:2+'(4(/%'!%-!'+ 4),1%)+!-*%@! 76'42/&,!,1%:*7!0+3/'9!! A%**40%)4(/%'!@/(1!BACD!/,!4*,%!)+&%22+'7+75!,/'&+!/(!/,!(1+!3%?+)'/'3!0%76!%-!(1+! EFG5!(%!34/'!4&&+,,!(%!:'.:0*/,1+7!,:)-4&+!&:))+'(!74(4!4'7!&)+4(+!4!&%'(/':4*! &%22:'/&4(/?+!)+*4(/%'!/'!)+34)7,!(%!4**!(6.+,!%-!74(49!!H)4'(,!-%)!8% )!)+I:+,(,!(%AJ!,4(+**/(+!4(!(1+!E+,%42+)/&4'!C++-!4)+4!&%:*7!4*,%!0+! .:),:+75!4,!@+**!4,!:,/'3!A>LGC9! ! ! ! ! ! ! !

PAGE 66

! "" !"#"$"%&"'( ) #$%&'(!)*+!,-./%-'!01+!234..4$5 !6*+!7$&'-8!6+!94'-8!)7:!;<<=:!>4?&$!.-@$-'A83%-'B! 4C!?4.&$!.--C!CA83!@4@/$&BA4'8!A'!&!%&.A'-!.-8-.D-:!6?A-'?-!EFGH!=I; J I": #'5-.84'!K:!&'5!)A$?3.A8B!6:!;<&/5-.5&$-!SV>T:! ,&/%8!1 ,+!W/Q3-8!N*+!W-$$X-.Q!0O:!;<<" :!0-'5-$A&'!%A?.48&B-$$AB-!$4?A!C4.!B3-! N&.AXX-&' !?4.&$! ,-&%#%&'(#'$.'*' :!0&. A'!O?4$ 4Q( !7.4Q .-88 !6-. A-8 !;LLHFF" J F;=: ,&/%8!1 ,+!0A$$-.!0R+!W-$$X-.Q!0O:!;<<" :!*-QA4'&$$(!A84$&B-5!@4@/$&BA4'8!4C!&'! A%@-.A$-5!N&.AXX-&'!?4.&$+! ,-&%#%&'(#'$.'*' :!04$ -?/$&. !O?4$ 4Q( !FIHFE== J Y<: ,&/%8!1,+!0A$$-. !0R+!W-$$X-.Q !0O:!;<A%'4$4Q(!& '5![?-&'4Q.&@3(!"FS"THFYGY J LF: ,/55-%-A-. !*R+!*4X-.B!R+! V&/BA' !K)+ !R&.!9* :!FYY=:!#??$A%&BA4'+!&5&@B&BA4'!&'5! &$Q&$!8(%XA48-8!A'!.--C J X/A$5A'Q!?4.&$8:! 1'H!5-'!W&.B4Q!9N+!-5AB4.:!N4-$-'B-.&B-! ,A4$4Q(:!7.4?--5A'Q8!4C!B3-!6APB3!1'B-.'&BA4'&$!N4'Q.-88!4C!N4-$ -'B-.&B-!,A4$4Q(U! FYY=U!M&B//.3A8B4.A8?3!0/8-/%+!>-A5-':!@:!=F J =G:! ,4B8C4.5!>R+!W&8BA'Q8!#+!)&A'-8!6K:!;<-BB-.8! IHFII J F"<: N$ACB4'+!\O!&'5! N$ACB4'!>0:!FYYL:!#!8/.D-(!4C!CA83-8!C.4%!D&.A4/8!?4.&$!.--C!3&XAB&B8! ]AB3!B3-!N&(48!N4?3A'48!0&.A'-!*-8-.D-+!W4'5/.&8!S67#T:!*-D A8B& 5-! ,A4$ 4Q ^ & 2.4@ A?&$ !IGS6ITH!F&X+! 1'8BAB /B-!4C!0&.A'-!&'5!N4&8B&$!6?A-'?-8+!*/BQ-.8!a'AD-.8AB(U!_?AB-5!;&.D&$!KA8@-.8&$!&'5!0&.A'-!74@/$&BA4'! N4''-?BADAB(:!#''/ &$ !*-D A -] 4C! 0&. A'!6?A -'?!FHIIE J GG: N4]-'!*\+!)&]&.eA-]A?f!)+!7A'-5&!9+!234..4$5!6*+!R-.'-.!VO:!;<<=:!74@/$&BA4'! N4''-?BADAB(!A'!0&.A'-!6(8B-%8H!#'![D-.DA-]:![?-&'4Q.&@3(!;
PAGE 67

! "# $%&'(!)*+!,-./0!$1+!2./(/3-0-(!45!677#5!28-9/(:!%;!8%(('8-./('! ?%?@9-0+!P@.-(:%!Q$RSC!)'?%.>'(I-/8!,.'00+!2-(!P/':%+!$45 $%&'(!)*+!U&/H-!*OO+!2?%(-@:9'!2+!,-./0!$1+!R90%(!P15!677 75!$%(('8! L<9f0@a L'-IB N%:-.<=!OJ!-(I!1%<0;%.I!UM5!677E5!,%?@9-'(/!g+!R>%./!O+!2L/>%/G'!*+!g-=-0L/a-.-!K+!g-<<-!O5!677A5!Z8%9%:/8-9!-(I! :'(''0!/(! !"#$%$#& 8%.-905 !O-./('!1/%9%:=!BW6C#EX D #\W5 F-/('0!2P+!F-=9%.I!1+!F'.a'.!U)+!g-0/%0-/8/0>!/(!?9-(<0!-(I!89%(-9 -(/>-905!4((@-9!)'3/'&!%;!Z8%9%:=!-(I!2=0<'>--(+!gO5!BXX\-5!$-=%0!$%8L/(%0!4.8L/?'9-:%+!g%(I@.-05! )'3 /0-(+!gO5!BXX\a5!P/3'.0/<=!%;!0<%(=+!0%;a'.9%;;!P5!BXXE5!KL'!>'<-?%?@9--/(+!-(I!-??9/8-/85!?5" D 6#5

PAGE 68

! "# $%&'()*&!+!%),!$%--(&.)!/0!12230!45'%6.678%'(.)!,9)%:(;&!%),!*5)5'(;&0!+))7%8! <5=(5>!.?!@;.8.*9!%),!/9&'5:%'(;&!A"B1C# D 1EE0 $5%8'F9!<55?&!G)('(%'(=5!H$)()*! %**-5*%'(.)&!F586!:%()'%()!?(&F!6.678%'(.)&B!%!-5=(5>!.?!;.))5;'(=('9!-5&5 %-;F!%),! 6-(.-('(5&!?.-!&;(5);5!%),!:%)%*5:5)'0!G)B!T-.R5D O7)&:.-5!!SP!5,('.-0! !^5>!_ .-N! J^_LB !MF%6:%)!%),!$%88 P!60VV10 `.F)&.)!4W0!12CK0![F5!.??&F.-5!,-(?'!.?!8%-=%5!.?!'F5!M%8(?.-)(%!&6()9!8.R&'5-! !"#$%&'$()&#*+''$,*$( 0!M%8(?.-)(%!M..65-%'(=5!U;5%)(;!\(&F5-(5&!G)=5&'(*%'(.)&! <56.-'&!#B!13# D C10 `.)5&!TSP!/-()(=%&%)!4P!+8:%)9!T<0!AKK#0!S .678%'(.)!M.))5;'(=('9!%),!M.)&5-=%'(.)! .?!4%-()5!Q(.,(=5-&('90!U;5%).*-%6F9!AKJVLB 1KK D 1110 `.)5&!TSP!S8%)5&!/!M0!12220!/58 ? D -5;-7(':5)'!()!%!;.-%8!-55?!?(&F! 6.678%'(.)0!^%'7-5!3KABEKA0 X%)5!^M!%),!X()*!4T0!AKK20!b&()*!6%-5)'%*5!%)%89&&!'.!5c%:()5!*5)5!?8.>!%),! &6%'(%8!*5)5'(;!&'-7;'7-50!4.8 5;78%!@;.8 .*9 !1EB1""1 D "A0 X5)9.)!`M0!122#0!4.,58&!.?!<5'(;78%'5!@=.87'(.)!()!'F5!M.-%8!T5)7&!+;-.6.-%!Q%&5,! .)!MF-.:.&.:5!^7:R5-&B!S%-%8858&!W('F!S8%)'&0!@=.87'(.)!"1JVLB!#"C D C#0 X-%:5-P!S0+0!%),!X-%:5-P!S0<0!J5,0!40!4;\(58,L0!AKKA0!@;.-5*(.)%8!M.)&5-=%'(.)! S8%))()*!?.-!'F5!45&.%: 5-(;%)!M%-(RR5%)!<55?0!W%&F()*'.)P!O0M0P!W.-8,!W(8,8(?5! \7),0 4%)58!/P!T%**(.'(!U@P!W%685&!('F!%66-.6-(%'5!'5;F)(d75&0![-5),&!()!@;.8.*9!%),!@=.87'(.)!AKB1VC D 3A0

PAGE 69

! "# $%&'(!)*!)+,-%./0!$1*!2345%./!6 *!7%8'.('/!9:!;<<=:!2%&>?+%@'!A'&'/4+?B!CDE84&4&A! (%&>?+%@'!'+D(DAF!%&>!@D@3(%/4D&!A'&'/4+?:!7.'&>?!4&!G+D(DAF!%&>!GHD(3/4D&!I#B! I#J K IJL: $D&3E'&/D!M%/3.%(!$%.4&D!N$M$O:!;<<#:!9(%&!>'!E%&'PD!>'(!$D&3E'&/D!M%/3.%(! $%.4&D!Q.+,4@4 R (%AD!C%FD?!CD+,4&D?*!SD&>3. %?!;<<# K ;!$3(('. K 2%&>%3!SC:!;<<<:!)@%/4%(!9%//'.&?!DU!)''>!V4?@'.?%(*!/,'4.! V'/'.E4&%&/?!%&>!CD&?'W3'&+'?!UD.!T'+.34/E'&/:!7.'&>?! 4&! G+D( DAF!%&> !GHD( 3/4D& I"B;X# K #": M%H%(!9D?/!6.%>3%/'!)+,DD( !NM9)OYZ&/'.&'/[ :!Y3@>%/'>!;<!;3_&DE_>%FI_@%./+:,/E( ](?D&*!V:!$:!%&>!G:!V4&'.?/'4&:!;<<;: !7,'!6(D8%(!;<'&!#JBI;" K I;L : H%&!]@@'&!$\S*!a4((4?!`2*!$4(('.!V\:!IJJJ:!Q/F@4+%((F!(D-!.%/'!DU!+F/D+,.DE'!8! 'HD(3/4D&!4&!/,'!?+('.%+/4&4%&!+D.%(!A'&3?! !"#$%$#& :!7,'!TDF%( !)D+4'/F!;LLB!IXJ K I#=: 94&'>%!\*!S%.'!\Q*!)@D&%3A('!):!;<!V4?@'.?%(!4&!/,'!CD%?/%(! ]+'%&!%&>!CD&?'W3'&+'?!UD.!9D@3(%/4D&!CD&&'+/4H4/F:!]+'%&DA.%@,F!;%!\:!%&>!2D@'0!$:!;<<;:!7'E@'.%/3.'*!?/.%/4U4+%/4D&!%&>! 8%.&%+('!(%.H%(! ?'//('E'&/!4&!/-D!C%(4UD.&4%!?4/'?:!CD&/4&'&/%(!),'(U!T'?'%.+,!;;NIOBI#= K J#: 94&'>%!\:!IJJb:!Z&/'.&%(!/4>%(!8D.'?!4&!/,'!&'%.?,D.'B!a%.E K -%/'.!U.D&/?*!?'%-%.>! A.%H4/F!+3..'&/?!%&>!/,'!D&?,D.'!/.%&?@D./!DU!&'3?/D&4+!(%.H%':!\D3.&%(!DU!$%.4& '! T'?'%.+,!";B!b;X K "#: 94&'>%!\:!IJJJ:!C4.+3(%/4D&!%&>!(%.H%(!>4?/.483/4D&!4&!4&/'.&%(!/4>%(!8D.'!-%.E!U.D&/?:! 24E&D(DAF!%&>!]+'%&DA.%@,F!bbNIOBb<< K Ib: 94&'>%!\:!;<<<:!24&54&A!(%.H%(!?'//('E'&/!/D!(%.H%(!/.%&?@D./B!Q??3E@/4D&?*! @D/'&/4%(?*!%&>!@4/U%((?:! ]+'%&DA.%@,F!DU!/,'!G%?/'.&!9%+4U4+ZB#b K I<": 9(%&'?!):!;<<;:!`4DA'DA.%@,F!%&>!(%.H%(!>4?@'.?%(!4&U'..'>!U.DE!@D@3(%/4D&!A'&'/4+! %&%(F?4?:!Z&!)%('!9c*!'>4/D.?^! '"$($)*+$,+-$#&(+.//,+0123/24+./"/56+!78&5"/2 ^!)%&!V4'ADB! Q+%>'E4+: 934(( K )/'@,%&!G*!a4((4?!`2* !H%&!S'.-'.>'&!2 *!H%&!]@@'&!$\S:!;<!Q>3(/!9D@3(%/4D&?!DU!/,'!`.D%>+%?/!)@%-&4&A!CD.%(! !"#$%$#&+91((/%$#& !D&!/,'! 6.'%/!`%..4'.!T''U:!92D)!]MG!bNIIOB!'XX"I:!>D4BI<:I=XI_PD3.&%(:@D&':<<
PAGE 70

! "# $%&'( ) *+,-&./!01!2/'&3!41!56/77/.-!$1!0.%'&3! $8!9::#8!;3<=>%<='+!?/''&?<=@=%7='&!B/B,.%<=/'3C!%'!&>B=7=?%.!&@%.,%<=/'!/D!%33=+'>&'B/7<%'&'/7&!Q1!L&..&7!TS1! &-=B.=?%<=/'3!D/7!F%7='&!07/<&?<&-!*7&%! F%'%+&>&'<8!07/?&&-='+3!/D!%!$B&?=%.!$A>B/3=,>!"# <6 !*'',%.!F&&<='+!/D!<6&!4,.D!! %'-! M%7=RR&%'!K=36&7=&3!O'3<=<,<&U!9::J!V/@!# ) GGU!T&.=(&!M=%'A!Z='-3!/D!='-=@=-,%.3!%7&!<6&7&[8!5 7&'-3!='!;?/./+A!%'-! ;@/.,<=/'!G\CG"9 ) G""8 $?6&.<&>%!Q$8!G#HJ8!]/'+ ) -=3<%'?&!-=3B&73%.!RA!B.%'Z/'+!<6&!M&'<7%.!0%?=D=?!=3.%'-38!T,..&<='!/D!F%7='&!$?=&'?&! ^#C!9\G ) "J8 $B%.-='+!FS1!K/_!P;1!*..&'!4Q1!S%@= -3/'!V1!K&7-%'%!`*1!K='.%A3/'!F1!P%.B&7'!T$1! 2/7+&!F*1!]/>R%'%!*1!]/,7=&!$*1!F%7<='!LS1!F?F%',3!;1!F/.'%7!21!Q&??6=%!M*1! Q/R&7<3/'!28!9::I8!F%7='&!;?/7&+=/'3!/D!<6&!N/7.-C!*!T=/7&+=/'%.=(%<=/'!/D!M/%3<%.! %'-!$6&.D!*7&%38!T=/3?=&'?&!"IWIXC"I^ ) "H^ 5%B=%!K!% '-!0='&-%!28!9::I8!$<%+& ) 3B&?=D=?!-=3<7=R,<=/'!/D!R%7'%?.&!.%7@%&!='! '&%736/7&!E%<&73C!0/<&'<=%.!D/7!.=>=<&-!-=3B&73%.!%'-!6=+6!>/7<%.=B/ ) 5/77&3!K1!K,?63!P1!0%7'&..!;1!F/'<&7/!01! Q%>/3!$8!9::\8! P=+6 ) D7&a,&'?A!/R3&7@%<=/'3!/D!E=') D/7?&-!/'36/7&!<7%'3B/7RA1!V81!F=..&7!L81!F,'-A1!M8!9::I8!;@=-&'?&!/D!+&'&<=?!3,R-=@=3=/'!%>/'+! B/B,.%<=/'3!/D!R.%?Z.=B! %R%./'&!WP%.=/<=3!7,R7%!]&%?6X!='!5%3>%'=%8!F%7='&!%'-! K7&36E%<&7!Q&3&%7?6!"HC!I^^ ) I\98 56/77/.-!$Q1!`%?6&7.!SM1!]&@='!]*8!9::I8!0/B,.%<=/'!M/''&?<=@=< A !%'-!]%7@%.! S=3B&73%.!c3='+!4&/?6&>=?%.!$=+'%<,7&3!='!M%.?=D=&-!$<7,?<,7&38!Y?&%'/+7%B6A! 9:W^XC H: ) H#8 56/77/.-!$Q1!2/'&3!401!0.%'&3!$1!P%7&!2*8!9::J8!57%'3+&'&7%<=/'%.!>%7Z='+!/D! &>R7A/'=?!/%7='&!D=36&3!,3='+!R%7=,>!3<%R.&!=3/
PAGE 71

! "# $%&'()*+!,-(%)'!.#//!012!.345!671(8198)!:2;?@@-;1*%185)25&*A*5A;7@>&98(-1%(;B*@;:2@#/ C /DDD@(B')E5=%<8 FB')2G;;'H!I5!.##J5!K;&%(B)!1B' !212)!A)B)%(-!-;BB)-%(;B*!(B!-;218*!;::!B;2%=G)*%! 6&*%218(1!1B'!%=)!(<>8(-1%(;B*!:;2!-;B*)271%(;B5!L=M!%=)*(*5!FB(7)2*(%N!;:!O)*%)2B! 6&*%218(15 O1881-)!6K5!/PJ"5!Q=)!R);A21>=(-18!M(*%2(9&%(;B!;:!6B(<18*?!O(%=!1!$%&'N!;:!%=)! K)81%(;B*!;:!S(7(BA!1B'!TE%(B%!U1&B1*!1*!T8&-('1%(BA!%=)!L1*%!V=1BA)*!;:!%=)!T12%=W*! $&2:1-)5!S;B';B?!01-<(881B5 O)2B)2!UTH!V;G)B!KXH!L12(*!VY5!.##J5!V;&>8)'!Y(;8;A(-18!1B'!L=N*(-18!0;')8*?! L2)*)B%!V1>19(8(%()*!1B'!Z)-)**12N!M)7)8;><)B%*!:;2!U&%&2)!$%&'()*!;:!L;>&81%(;B! V;BB)-%(7(%N5 ![-)1B;A21>=N!.#\D]? 3^ C "_5 O=(%=181B% C =)29(7;2)! (B%)21-%(;B*H!1B'!<;*1(-*!;:!A)B)%(-!712(19(8(%N?!Q=)!1'1>%(7)!*(AB(:(-1B-)!;:!*;<1%(-! <&%1%(;B*!(B!>81B%*5![)-;8;A(1!^_?!.PJ C ._.5 O(8`(B*;BH!V5!\ .##P]5!$%1%&*!;:!-;218!2)):*!;:!%=)!G;28'?!.##P5!R8;918!V;218!K)):! 0;B(%;2(BA!Z)%G;2`!1B'!K)):!1B'!K1(B:;2)*%!K)*)12-=!V)B%2)H!Q;GB*7(88)H! 6&*%218(1H! >5!._" 5 O;28'!O(8'8(:)!U&B'!\OOU]!,aB%)2B)%45!,-(%)'!.#//!U)9!/#45!O1*=(BA%;B!\MV]5! 671(8198)!:2;?@ @GGG5G;28'G(8'8(:)5;2A@*-()B-)@)-;2)A(;B*@<12(B)@(%)?@@GGG5G;28'G(8'8(:)5;2A@G=1%@G=)2)G)G;2`@<)*;1<)2(-1B2)):@

PAGE 72

! "# !""#$%&'()* ( +#$#,-.(/0$/#"12(30,(4&/,02 -1#..&1#(56!(-$%(17#(80.94#,-2#(:7-&$(;#-/1&0$( <8:;= ( Basic Concepts and Some History in DNA Fingerprinting DNA can consist of billions of nucleotide base pairs (bps), as in the case for human DNA. But interestingly, many current applications, research and studies make use of sequences of only 1 6 nucleotide bps that are repeated in tandem, to help make sense of the billions present. These occurrences of "simple sequence repeats" (SSRs) or "short tandem repeats" (STRs) in DNA are called microsatellite D NA (msDNA/microsatellites). One very common and well popularized application of using msDNA is DNA "fingerprinting." The methodology of DNA fingerprinting/profiling was pioneered by Sir Alec Jeffreys and his colleagues in 1985. In their experiment they w ere able to capture and mark many hypervariable regions on alleles consisting of repeat sequences of 10 15 bp long (Jeffreys et al. (a) 1985). Even back then, they correctly hypothesized some of applications of their discovery for the use in individual id entification, paternity tests, and for ecology and conservation biology (ScienceWatch Interviews 2004). Today, the methodology for DNA fingerprinting has been improved and refined with the use of polymerase chain reaction (PCR). Now, minute amounts of DN A or targeted fragments can be amplified by PCR (Roche) and then put through gel electrophoresis to create the distinctive banding that makes up the DNA "fingerprint" (Jeffreys et al. (b) 1985).

PAGE 73

! "# Today the applications of microsatellite DNA are used in in dividual identification, family relatedness studies, paternity tests, human population divergences, conservation biology and ecology, gene mapping of the human genome, disease identification, cancer pathology and hereditary disease studies. Only a portion of our DNA called coding regions are transcribed into the different types of RNAs that drive our cellular processes. The non coding regions were conventionally called as "junk" DNA. It is within this junk DNA that many repetitive sequences of nucleotide s were found. One type of repetitive sequences is DNA satellites. The term "satellites" is used to refer to larger sequences, greater than 100 d bps, whose repeats are large clusters that range in the kilobases(kb) and megabases(mb). These satellite DN As are generally found at the centromeres and telomeres and do not have the characteristic of highly variable repeat numbers (Tautz et al. 1984 and 1989, Cheng et al. 2002). The next type of repetitive sequences is minisatellite DNA which range from 5 to 100 d bps with clusters of up to 30kb (Koreth 1996). They are located in euchromatic regions and have the high variability that it can be used as a marker in DNA as well (Armour and Jeffreys 1992). This is the type of repeat sequence that Jeffrey and his team marked in their ground breaking discovery in 1984. Lastly, we have microsatellite DNA. These sequences are only 1 to 6 d bps long with clusters of 100 d bps on average (Koreth 1996). They are ubiquitous, highly polymorphic, and are found both in t he coding and non coding segments of the DNA (Tautz et al. 1984 and 1989, Beckmann and Weber 1992, Weissenback 1993, Tyler and Willard 1993).

PAGE 74

! "# Why msDNA is ubiquitous is not fully understood at the present. To give an idea how proliferant they are msDNA is calculated to be 10 15 percent of the human genome (Beckmann and Weber 1992, Naidoo and Chetty 1998). The most common microsatellite is the d A monomer repeat, but they are not used as markers because they can degrade easily and are proliferant in the co ded regions, thus its presence and repeat lengths are suspected not to be genomic in origin, but "selected" for gene activity pathways (Tautz 1989, Koreth et al. 1996). The next most common msDNA is (dC dA)n, which is calculated to occur between 55,000 to 100,000 times, giving a density of 1 msDNA for every 100,000 d bps (Koreth et al. 1996, Nadir et al. 1996). The dC dA dinucleotide sequence is the main marker used for human gene mapping (Beckmann and Weber 1992, Cohen et al. 1992). MsDNA polymorphism i s the basis of its effectiveness as a marker on DNA and defines the "fingerprinting" technique. MsDNA is inherited in a Mendelian fashion (Jeffrey et al. 1985, Armour and Jeffreys 1992) and coupled with the cell's processes of allele swapping between the mother's and father's chromosomes (sometimes unequal), mutation from polymerase slippage, and defective mismatch repair systems over generations (Jeffreys et al. 1988 and 1990, Di Rienzo et al. 1994, Nadir et al. 1996), msDNA's polymorphism is generated. (It has to be noted that there is also msDNA mutation within a shorter period of time, a person's lifetime, which is categorized under microsatellite instability (msi) which can be detrimental to one's health and a "hiccup" in relatedness applications.) T here are other words/phrases that refer to DNA sequences in many studies that are worth mentioning to help clarify terminology seen in papers. "Alu sequences" are a

PAGE 75

! "# class of repetitive DNA, around 300 bp long, but are not highly polymorphic. Alu sequences are also called "short interspersed elements" (SINE). Other terms are "restriction fragment length polymorphism" (RFLP), "amplified fragment length polymorphism" (AFLP), and "random amplification of polymorphic DNA" (RAPD) all of which are techniques use d in genetic studies and research and do not depend on the polymorphism of repetitive sequences, but the polymorphism of the DNA strand itself. Polymerase Chain Reaction (PCR) The main technique used to amplify msDNAs, RFLPs, AFLPs, and RAPDs that then c an be studied is PCR. In 1993 Dr. Kary Mullis won the Nobel Prize for his invention of the PCR technique in 1983. The basic concept behind PCR is that it can amplify DNA fragments up to millions of copies. The DNA fragments may have been specifically ta rgeted or not. It is good to know the technique because it is an integral step to the whole process of DNA analysis, fingerprinting, and mapping. The main components of PCR are the thermal cycler, TaqPolymerase enzyme, deoxynucleoside triphosphates (DNA building blocks), and primers (DNA oligonucleotides) (Mullis 1990). In one amplification cycle, PCR produces 1 copy of the DNA fragment, giving you 2 DNA fragments. The next cycle gives you 4, then 8, then 16, and so on. After 21 cycles you can have 1 ,048,576 copies of that one DNA fragment. Each cycle has different steps for this process of amplification. Each step and number of amplifications are controlled by the thermal cycler. It is called "thermal" because each step has "ideal" temperatures fo r the process to unfold.

PAGE 76

! "# The first steps are the initialization and denaturing step (94 96 degrees C), a double stranded DNA fragment splits into 2 strands. The next step is the annealing step (30 65 degrees C) where two (forward and reverse) primers bin d to the sense and anti sense single stranded DNA at their 3' ends, "flanking" the fragment to be amplified. In this step the TaqPolymerases also attaches to the DNA substrate at the site of the primers. TaqPolymerase is a specific type of polymerase enz yme taken from Thermus aquaticus a bacterium found in the hot springs of Yellowstone Park. The denaturation step mentioned earlier are at temperatures that denature protein as well, such that the first type of polymerase enzyme used, isolated from E. coli had to be added at every cycle (Saiki et. al 1985). With the use of TaqPolymerase, PCR became more efficient because the polymerase enzymes survived through the higher temperatures of the denaturing step (Saiki et. al 1988, Mullis 1990). TaqPolymerase (TaqPol) is the most commonly used polymerase enzyme for PCR. In the Elongation step (60 70 degrees C), TaqPol synthesizes the complementary strands and the result is 2 double stranded DNA fragments. This cycle can then be repeated as many times as neede d. The PCR technique is used extensively for DNA amplification because it can be highly selective and is less laborious and time consuming than the traditional gene cloning/amplification by cell culturing. Differentiating Populations Jeffreys continued his research on repetitive sequences and their mutations (Jeffreys et. al 1985, 1988, 1990), but at the level of minisatellites. Although his discovery of minisatellites allows the differentiating of two individual organisms, what about groups of organism s?

PAGE 77

! "" Tautz and Renz took a systematic study of these microsatellites, in particular the poly (dA), poly (dT), poly (dT dG), and poly (dC dA) (1984). They took many different samples from phylogenetically different organisms among eukaryotes and found many sequences of dT dG and dC dA across the board, proposing that all types of repetitive sequences were present in all eukaryotic genome. They also proposed that the mechanism of the polymorphism arose fro m replication slippages and allele swapping. Soon after, more studies showed that the (dC dA)n and (dT dG)n were the most abundant in of repetitive DNA families in the human genome (Tautz 1989, Weber and May 1989, 1990, Beckman and Weber 1992, Cohen et. a l 1992). The potential for microsatellites as genetic markers was being proved in the process. They are so abundant in DNA such that they can be found on coded and non coded regions of the DNA (Cohen et. al 1992, Beckman and Weber 1992). As the data com piled and the probabilities more robust, patterns were being revealed, studied, and applied to make inferences in genetic histories. One application of using the patterns of microsatellites is in differentiating populations spatially or by its age. This has been very helpful in conservation biology, and ecosystem studies and are generally called "assignment tests" and "parental analysis." In Australia, since abalone and corals are a commercial industry many studies of their populations have been made. T hey had found that some abalone populations are delineated by as little as 100 meters (Temby et. al 2007) and in coral populations as well (Underwood 2007). Decision making concerning their conservation is now being influenced by these insights of spatial dimensions (Conversations with Prince and Mundy 2008).

PAGE 78

! "# Since the position of microsatellites is highly conserved, you can look for them on specific loci and increase confidence by looking at more than one locus. In one study, they calculated that the pro bability of 2 human individuals to have the same "fingerprint" using only 14 loci is 10 14 (Kimpton et. al 1993). Also with microsatellites, you can infer which population is older, basically, the more polymorphic the microsatellites, the older the popula tion (Weissenback 1993). In population studies, it is shown that looking at only 36 loci is enough to differentiate which human populations are older (Jorde et. al 1997). As an example, both the Weissenback (1993) and Jorde et. al (1997) studies accept the hypothesis that the African population is the oldest population among modern man. Microsatellite mutations The key mechanisms associated to microsatellite polymorphisms are through allele swapping between parental chromosomes, polymerase slippage, an d defective mismatch repair complexes. The least understood of these 3 is polymerase slippage. Di Rienzo et. al (1994) and Koreth (1996) proposed the one step model wherein the polymerase slips off and one sequence twists upon itself, placing its two nei ghbors side by side by the time the polymerase continues to replicate. If the twist is on the new strand, there will be an addition of 1 sequence, if on the template there will be 1 deletion. But large expansions have also been observed such that it was suspected that the larger the number of repeats within a sequence, the more predisposed it is to expansion according to Richards and Sutherland (1992). They and another study (Koreth et. al 1996), postulated as well that larger repeats of over 80 now have 2 ends for slippage if they comprised the whole Okazaki fragments. There is still debate whether shorter

PAGE 79

! "# repeats are more stable than longer ones. In another study slippage was induced, in vitro, using E. coli and the results showed that it didn't matte r how many original repeats there were to induce slippage (Schlotterer and Tautz 1992). But no matter whether it is a rampant extension or a single step addition/deletion, microsatellite mutations need both polymerase slippage and inhibited mismatch repair complex (Schlotterer 2000). At the moment, the rate of mutation used in analysis is calculated using empirical evidence gathered so far. Beckman J.S., Weber J.L. 1992. Survey of human and rat microsatellites. Genomics 12:627 631. Armour, J.A., Jeffre ys A.J. 1992. Biology and applications of human minisatellite loci. Curr Opin Genet Dev 2:850 56. Cheng, Z., Dong, F., Langdon, T., Ouyang, S., Buell, C.R., Gu, M., Blattner, F.R., Jiang, J. 2002. Funtional rice centromeres are marked by a satellite repea t and a centromere specific retrotransposon. Plant Cell 14(8):1691 704. Cohen, B.B., Wallace M.R., Crichton, D.N. 1992. A comparison of procedures for analyzing microsatellite (CA) repeat polymorphisms. Mol Cell Probes 6:439 442. $%&'()*+,-%&*!.-,/!0()(1 2!3)-&4(!+&5!$)+-6!78&52!+,!,/(!9 ,/ !:;%)-5+!<,+,(! =&-'()*-,2! >-;;-+1!?@!+&5!A(%&%)(!7%,(!B&,()&+,-%&+;!<21C%*-81@!DEE#@!7%,(! 7+)-&(!A+F%)+,%)2@!<+)+*%,+G!:;%)-5+@! Di Rienzo, A., Peterson, A.C., Garza, J.C., Valdes, A.M., Slatkin, M., Freimer, N.B. 1994. M utational process of simple sequence repeat loci in human populations. Proc Natl Acad Sci USA 91:3166 3170. H+I!0(JJ)(2*G!K@0@G!>-;*%&G!L@G!M/(-&G!<@A@!NO#P@!Q2C()'+)-+F;(!R1-&-*+,(;;-,(S!)(6-%&*!-&! /81+&!TUK@!U+,8)(!VNWH"EE"IX"9 Y 9V@ HFI!0(JJ)(2*G!K@0@G!> -;*%&G!L@G!M/(-&G!<@A@!NO#P@!B&5-'-58+; Y *C(4-J-4!RJ-&6()C)-&,*S!%J! /81+&!TUK@!U+,8)(!VN"H"EDVIX9" Y 9O@ 0(JJ)(2*G!K@0@G!?%2;(G!U@0@G!>-;*%&G!L@G!>%&6G!Z@!NO##@!
PAGE 80

! "# $%&&'%()*!+,$,*!-%./011*!2,*!345)61*!7,!8##9,!2%:%0;!.14;!)%<.%1=%!>0'40;461!41! /414)0;%554;%)?!0!16>%5!)6.'=%!6&!@-+!:65(/6':A4)/!&6'!);.B(41C!>0'40;461!01B! /.;0;461!D(!)41C5%!/65%=.5%!0105()4),!E%55!"9FGH?IJG K LM, $6'B%*!N,O, *!26C%')*!+,2,*!O0/)A0B*P,*!30;Q41)*!3,R,*!S'0Q6T40Q*!U,*!R.1C*!R,*!S%'%*!$,*! V0':%1B41C*!V,E,!8##J,!P4='6)0;%554;%!B4>%')4;(!01B!;A%!B%/6C'0:A4=!A4);6'(!6&! /6B%'1!A./01),!U'6=!-0;5!+=0B!R=4!#I?G899 K 9G, S4/:;61*!E,U,*!W455*!U,*305;61*!+,*!X'<.A0';*!+,*!P45 54=01*!Y,R,*!+B0/)!P,!8##G,!@-+! :'6&4541C!%/:56(41C!/.5;4:5%Z!0/:54&4=0;461)!6&!)A6';!;01B%/!'%:%0;!56=4,!UE2! P%;A6B)!+::5!G?8G K [[, S6'%;A*!$,*!\]N%0'(*!$,$,*!P=W%%*!$,\,!8##",!P4='6)0;%554;%)!01B!UE2!C%16/4=!0105()4),! $6.'105!6&!U0;A656C(!8JL?[G# K IL, P.55 4)*!S,!O,*!^056610*!^,!+,*!R=A0'&!R,*!R04Q4*!2,!S,*!V6'1!W,*!Y'54=A!V,!+,!8#L",!R:%=4&4=! %1_(/0;4=!0/:54&4=0;461!6&!@-+!41!>4;'6?!;A%!:65(/%'0)%!=A041!'%0=;461,! E65BR:'41CV0'D6'!R(/:6)40!61!`.01;4;0;4>%!O4656C(, P.554)!S,!O,*!^056610!^,!+,!8#LJ,!R:%=4&4=! )(1;A%)4)!6&!@-+!41!>4;'6!>40!0!:65(/%'0)% K =0;05(_%B!=A041!'%0=;461,!P%;A6B)!41!Y1_(/656C(!8MM?GGM K M9, P.554)*!S,!O,!8##9,!aA%!.1.).05!6'4C41!6&!;A%!:65(/%'0)%!=A041!'%0=;461,!R=4%1;4&4=! +/%'4=01!["[FIH?M" K "8*!"I K "M, -0B4'*!Y,*!P0'C054;*!V,*!W05545(*!a,*!O %1 K R0))61*!R,+,!8##",!P4='6)0;%554;%!):'%0B41C!41! ;A%!A./01!C%16/%?!Y>65.;4610'(!/%=A014)/)!01B!);'.=;.'05!4/:54=0;461),!U'6=!-0;5! +=0B!R=4!XR+!#G?"IJ9 K JM, -04B66*!2,*!EA%;;(*!2,!8##L,!aA%!0::54=0;461!6&!/4='6)0;%554;%)!41!/65%=.50'! :0;A656C(,!U0;A656C(!\1 =656C(!2%)%0'=A!IFIH?G89 K 8M, 24=A0'B)*!2,b,*!R.;A%'501B*!W,2,!8##[,!@(10/4=!/.;0;461)?!0!1%T!=50))!6&!/.;0;461)! =0.)41C!A./01!B4)%0)%,!E%55!J9?J9# K 8[, 26=A%,!UE2?!+1!6.;);01B41C!/%;A6B,! A;;:?ccTTT,'6=A%,=6/c:0C%)c&0=%;)c:='d%,:B& R=A56;;%'%'!E,*!a0.;_*!@,!8##[,!R54::0C%!)(1;A%)4)!6&!)4/:5%!)%<.%1=%!@-+,!-.=5%4=! +=4B)!2%)![9?[88 K 8M, R=A56;;%'%'*!E,![999,!Y>65.;4610'(!B(10/4=)!6&!/4='6)0;%554;%!@-+,!EA'6/6)6/0! 89#?G"M K J8, R=4%1=%30;=A!b1;%' >4%T),![99G,! A;;:?cc0'=A4>%,)=4%1=%T0;=A,=6/c41;%'>4%T)c)4'd05%=de%&&'%(),A;/ a0.;_*!@,*!2%1_*!P,!8#LI,!R4/:5%!)%<.%1=%)!0'%!.D4<.4;6.)!'%:%;4;4>%!=6/:61%1;)!6&! %.Q0'(6;4=!C%16 /%,!-.=5%4=!+=4B)!2%)!8[?I8[J K I8GL,

PAGE 81

! "# $%&'()!*+!,-.-+!/01234%35%6575'0!89!:5;172!:2<&2=>2:!%:!%!?2=23%7!:8&3>2!983! 1870;831@5>!*AB!;%3C23:+!!A&>725>!B>5D!E2:!,"FGHIG J ",+ $2;60)!A+)!K57723)!L+)!K&=D0)!M+!N##"+!O45D2=>2!89!?2=2'5>!:&6D545:58=!%;8=?! 181&7%'58=: !89!67%>C751!%6%78=2!P !"#$%&$'()*+)" !Q2%>@R!5=!$%:;%=5%+!K%35=2!%=D! S32:@T%'23!E2:2%3>@!U.F"II J HN+ V=D23T88D)!W+!N##"+!E8&'5=2!%=D!3%32!?2=2'5>!>8==2>'58=:!5=!>83%7:!899!=83'@T2:'! B&:'3%75%!%=D!'@2!5;175>%'58=:!983!>8=:234%'58=+!!X@+!*!'@2:5:+!V=5423:5'0!8 9!Y2:'23=! B&:'3%75%+ Y25::2=6%>C!W+!,--I+!K5>38:%'2775'2!1870;831@5:;:!%=D!'@2!?2=2'5>!75=C%?2!;%1!89! '@2!@&;%=!?2=8;2+!M&33!Z15=![2=2'!*24!IFH,H J ,"+ ! !

PAGE 82

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( !""#$%&'(&&)(*+,-&$.(/!0(",+1+2+/3 ( ( /456748679(#:;<7=>.;",(>"5*%&",?(@"&AB#., ( C#+D.#+A(/;E(:7/+#6"(0+&%1 ?( FGHFGHI33 ( ( &@ 0ABB#,3(!$%(3+/A1&+$3 ( ( !@ ( 3-("<()J K LB<<+# ( ( !@C@ ( ( IMN(4(J8):?(OMID@ ( ( Name Formula M Mass (g) melt (C) boil (C) HAZARDS EDTA C10H14N2O8Na2.2H2O 372.23 237 245 na Irritant NaOH 39.99711 318 1388 CAUSES BURNS ( ( C#+D.#+(3I =7("<(3I4(9.P@ E ( ( ( 3I =7(J#7+&=+;+#(<7.,$( ( 8 %,,"7Q+(F'(9.P@(%&(N =7("<(@HP ( ( ( :AA(@HP(6"(3I =7 ( ( ( C#+D.#+(3I =7?(IMN4(J8): ?(OMID@ E ( ( ( 3 I=7(J#7+&=+;+#(<7.,$( ( 8 %,,"7Q+(3 MOR3'(9.HJ8):MH@HP(%&(2 =7(@HP ( ( ( :ASB,6(D@(6"(OMI(T%6*(3I4(9.P@(U.#"B&A( IM N=7V ( ( ( :AA(@HP(6"(3I =7 ( (

PAGE 83

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( !"#" (( 3 4456("7(89()#%, : ;6(<=#%,>*?@#"1?5+=*?6A.5%&"5+=*.&+B ( ( Name Formula M Mass (g) melt (C) boil (C) HAZARDS Tris base C4H11NO3 121.14 175 176 219 Harmful if swallowed, Irritant HCL 36.46 27.32 110 CORROSIVE, reacts strongly, chlorine gas (w/ oxidants) ddH2O ( ( ( 84456(C#6+&5+?+#(76.,$( ( D%,,"6E+(3FG33H'()#%,(/.,+(%&(8I 456(J3K ( ( >3FG33H'A>85"6L838G8F'A(M(4G35"6 ( ( >34456A>8-L844456A(M(4G3( ( 4G35"6L4G3-(M(89( ( ( ( N@OP,=(QJ(="( HG4(R%=*(S"&S+&=#.=+@(J;(>"#( 88GI5-("7(849(J;6(,"6T&A ( ( ( N@@(.&@(5%1(J3 K(="(3 4456 ( ( ( ;*+S$(QJ ( ( !"$" (( 8-("7 ( )C(UP77+# V(HG4QJ ( ( W"P(R.&=(8459()#%, : ;6V(Q*(HG4(.&@(859(CD)NV(HG4Q*(>84X8()C(UP77+#AG ( ( ( 8-(C#6+&5+?+#(76.,$( ( N@@(8456("7(89()#%, : ;6 ((<>89A>8456AM>4G4 89A>844456AB ( ( ( N@@(.&@(5%1(356("7(4GY9(CD)N (<>4GY9A>356AM>4G4489A>844456AB ( ( ( N@@(.&@(5%1(J3K(="(8( ( % % %

PAGE 84

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( !" (()4 5 6788+#+9(:*+&"; ( ( Name Formula M Mass (g) melt (C) boil (C) HAZARDS 8 Hydroxyquinoline C9H7NO 145.16 76 276 FLAMMABLE, LIGHT SENSITIVE Phenol C6H6O 94.11 40.5 181.7 TOXIC, CORROSIVE Tris Base C4H11NO3 121.14 175 176 219 Harmful if swallowed, Irritant Tris Cl 8.0pH --------Harmful if swallowed, Irritant ( !"#" ((<("8(=>?@()#%,(/.,+(A7&.9B7,C+9(DE <>F=G ( ( ( ( <(4#;+&?+H+#(8;.,$ ( I99( J F >=2> '()#%,(/.,+( ( ( ( I99(.&9(?%1(EKL(C"(<( ( ( ( A J F >=2>'GAF>=?";(O(=>??"; ( ( ( ( =>??";M<-(O(=>?@ ( ( !"$" (K-("8(=>?@()#%, 5 P;Q(DE(RF> ( ( ( ( K-(/+.$+#M8;.,$ ( ( ( I99(<>>?;("8(<@()#%, 5 P;Q(DE(RF> ( ( ( I99(.&9(?%1(EKL(C"(K( ( ( SA<@GA<>>?;G(O(A>F>=>@GAK>>>?;GT ( ( % %

PAGE 85

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( !"# ( (4566+#+7(8*+&"9 ( ( ( ( (:;(( 8#+<.#+(.&7(,=+#%9%>+(?"#$%&'(,<.@+( $%&'()&(**+ A ( (B;(( : -('9.,,( C#9+&D+E+#(69.,$ ( ( ( (F;((G77(HII'(8*+&"9(J7#EK(,*"597(/+(?*%=+(@#E,=.9,L(%6(<%&$("#(#+77%,*(=*+&(%=(*.,(.9#+.7E("1%7%>+7 M ( ( ( (3;(( N"O+#(?%=*(HH;HP D9(QBR (JHII'SI;TI(U(HH H;HP'(?*%@*(%,(="=.9(?+%'*=("6(.(TV:(#.=%"("6(<*+&"9(="(?.=+#L(5,%&'( ( HII'("6(<*+&"9M ( .&7(,?%#9(="(7%,,"9O+(<*+&"9 ( ( ( ( J 9%W5+6%+7(<*+&"9(%,( .=(9+.,=(XP;3Y(<*+&"9(.&7(:F;PY(7%,=%99+7(?.=+#(/E(?+%'*=(JG#&E(:TITML(/5=(%,(=E<%@.99E( ( ( <#+<.#+7(/E(7"%&'(TV:L( <*+&"9V7%,=%99+7(?.=+# L(/+@.5,+(%=(%,(9%W5%7(.=(#""D(=+D<;(.=(=*%,(<#"<"#=%"& (J!QR( :TT3MM ; ( (H;(( ).$+("5=("6(?.=+#(/.=*(.&7(.77 ( ,=%#(/.# ( (P;(( G77(I;H'("6(X Z *E7#"1EW5%&"9%&+( J I;:Y (="(<*+&"9 K( <*+&"9(?%99(=5#&(E+99"?K (X Z *E7#"1EW5%&"9%&+(.@=,(.,(.&( ( .&=%"1%7.&= M ( ( ( (2;(( [=%#(%&(=*"#"5'*9E ( (X;(( G77(+W5.9(O"95D+("6(HID\()#%,(4.,+ ( (T;(( N"O+#(/+.$+#(?%=*(.95D%&5D(6"%9;(([=%#(:I(D%&5=+,(.=(9"?(,<++7(?%=*(D.'&+=%@(,=%##+#(.=(#""D(=+D<+#.=5#+ ( ( ( :I;(( -+=(<*.,+,(,+<.#.=+(.=(#""D(=+D<; ( ( ( ::;(( ]+@.&=(="<(J.W5+"5,M(<*.,+(.&7 (7%,<",+(%&(.<<#"<#%.=+(?.,=+(#+@+<=.@9+ ( ( ( :B;(( G77(+W5.9(O"95D+("6(HID\()#%, Z N9L(X;I
PAGE 86

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( ( 456($++7%&'(6"#(8.9+#(:,+(.;;(3 < 2=8()#%, < >8(?7@(9"(/:66+#+;(7*+&"8A(B.7(.&;(,+.8(C%9*(7.#.6%8=A(!DEF(5G(E-H I5GHI(0J5-(9"( 7#"9+B9(6#"=(8%'*9(.&;(,9"#+(.9(K ¡ >L(()*+(7*+&"8(7#+7.#+;(C%9*(9*+(.& 9%"1%;.&9(B.&(/+(,9"#+;(6"#(:,+ (:7(9"(M=",LN ( ( !"#$%&'()%)&*+,%-%#./,%*)0+%1223%4'0.#/5%%-%+(6(+0+%$07(40%8,%95: % % % % % % % % ( % % % % % % % % % % % % % % % % %

PAGE 87

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( !!"## $%&!'!()*!+,#),-# (+,(.,*&)*!+,#+'#-,)#'&+/#)0%.+%1#1+2%*!+,1 ( # Name Formula M Mass (g) melt (C) boil (C) HAZARDS phenol C6H6O 94.11 40.5 181.7 TOXIC, CORROSIVE chloroform CHCl3 119.38 63.5 61.2 May be FATAL, AVOID ALL CONTACT isoamyl alcohol C5H12O 88.148 117.2 131.1 FLAMMABLE, Irritant sodium acetate CH3COONa 82 328 na FLAMMABLE, Irritant ethanol, 100% C2H6O 46.07 114.3 78.4 FLAMMABLE, Irritant ethanol, 70 or 90 % FLAMMABLE, Irritant TE buffer pH 8.0 Irritant (contains Tris hydrochloride, EDTA) # # )" (( 4*+&"5(617#.87%"& ( ( ( )"3" ((4#+9.#+(:;<5("=(>?(@"A%B<(.8+7.7+ ( ( ( ( :;<5(6#5+&<+C+#(=5.,$ ( ( ( ?%1(DEF >'(G%7*(:;<5("=(A%,7%55+A(G.7+# ( ( ( H*+8$(="#(9I(JFK L :FE( ( ( ( ( MDEF>'NMD<"5OKE'N(P(;FD:<"5 ( ( ( ( ;FD:<"5O;F;:;-(P(>? ( ( (

PAGE 88

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 22 ( ( !"# (3456("7(8398:9;(<=77+#+>(?*+&"6@A*6"#"7"#5@%,".5B6(.6A"*"6( ( ( ( ( ( $%&'()*&)+&'(,&(%%$-& & ( ( ( ( ( )*.C(D"(#""5(D+5?+#.D=#+(/=77+#+>(?*+&"6( ( ( ( 3456(E#6+&5+B+#(76.,$(C%D*(A"#$(D"? ( ( ( F%1(8356(/=77+#+>(?*+&"6G(8:56(A*6"#"7"#5G(.&>(;56(%,".5B6(.6A"*"6H ( ( ( I.?(76.,$(.& >(,+.6(C%D*(?.#.7%65(.&>(?=D("&(,D%##+#(D"(5%1(D*"#"='*6BH ( ( ( !". ((JKL(E1D#.AD%"&(M#"A+>=#+ ( ( ( ( ;H(( )*.C("=D(5=A=,@NKL6.D+#(,.5?6+, (%&(5%A#"A+&D#%7='+(D=/+, (D"(#""5(D+5?+#.D=#+H ( ( ( 8H(( I+&D#%7='+ >(,.5?6+,(.D(;8G444#?5(7"#(;35%&(.D(#""5(D+5?H(OI+&D#%7='%&'(.D (;:G444#?5(.&>(.D(: PI(>%>(&"D( ( %5?#"Q+(#+,=6D,R ( OSM)TSKL-(U)EM9(!.,*(UD+?(O,++(L??+&>%1(TT(,=??6+5+&DR ( VH(( N + >=A+(5%1D=#+(D"(.#"=&>(4H8 56(/ B(?%?+DD%&'("=D(+1A+,,(NKL6.D+# H ( ( ( ( !"#$%&#'()*+,-./01*,2*34 5 644 7*&%(*80*9'22'&.-#*:;<=>*6?@ABC :H(( L>>( 844 W-("7 (?* +&"6@A*6"#"7"#5@%,".5B6(.6A"*"6(D"( D*+(JKL(,"6=D%"&(D"(/+(?=#%7%+>H ( D')E*1%-#*&,(&0(#$%#',(1*&%(*&%.10*'(+0$1',(*,2*#E0*%F.0,.1*%(9*,$)%('&*GE%101C**HE0*,$)%('&*GE%10*&%(*80* '(90(#'2'09*8I*'#1*I0--,J*&,-,$C 3H(( X"#D+1( D"(5%1(,"6=D%"&H(O3(,+A"&>,R ( YH(( -+D(, .5?6+,(,%D(.D(6+.,D(;(*"=#(D"(,+?.#.D+(?*.,+,(.D(#""5(D+5?H ( O(T(.6,"(D#%+>(A+&D#%7='%&' (,.5?6+(7"#(;8,+A(D"(35%&(.D(#""5(D+5?+#.D=#+(D"(,+?.#.D+(?*.,+,H( (<=D(>+A%>+>(.'.%&,D( =,%&'(D*%,(D+A*&%Z=+R ( OT7(=,%&'(A+&D#%7='+(%&,D+.>("7(6+DD%&'(,.5?6+,(,%D9( *6?@PB C (

PAGE 89

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( 24(( 5+6"7+(8*+(8"9(:.;<+"<,=(9*.,+(>"&8.%&%&'(8*+(?@A(:<,+(BCC (9%9+88"#=(.&D(8#.&,E+#(8"(.(&+F(.&D((G./+G+D( (( ( ((((( 8:#(-?'/<:@#>=#': A :B%'&;%()*#/'*&)(;#?,&$:#+(%,# 6CC 7#DE#>0"":'F##3)@#%,:#&G0:/0$#?,&$:#"'/-#%,($#;&)#>:#?//.:@#+(%,#%,:#"('$%#:B%'&;%(/)F # ( ( 34(( HE(.(F*%8+(9#+>%9%8.8+(%,(9#+,+&8(.8(8*+(.;<+"<,I "#'.&%>(9*.,+J( #+9+.8(,8+9,(K L 24 ( ( ( ( M4((H(D%D(.(/.>$(+18#.>8%"&(.&D(.DD+D(BCC (NCOC4N()P L /*G"#"E"#6IHAA4((Q"#8+1+D(8"(6%1(.&D( ( .GG"F+D(8"(,%8(.8(#""6(8+694(E"#(.&(*"<#4((P18#.>8+D(8"9(.;<+"<,(G.R+#(.&D(.DD+D(%8(8"( E%#,8(+18#.>8%"&4(:H(*%'*GR( ( #+>"66+&D( 8"(D"(8*%,J(,%&>+(8*+#+(%,(&"8(6<>*(,.69G+J(6<>*(G+,,(?@A(%&(8*+(,.69G+= 4 ( ( ( !"# (P8*.&"G(S#+>%9%8.8%"& ( ( ( ( N4((ADD(NINC(7"G< 6+("E(TU(V "D%<6 (.>+8.8+4((U%1(8*"#"<'*GR(/R(7"#8+1%&'(/#%+EGR("#(/R(EG%>$%&'(8:#&@@:@F##3@<($&>.:#%/#M::?#2&H.#&)@#$/@(0-#&;:%&%:#;/);:)%'&%(/)$#>:./+# 5CFKLF##N':;(?(%&%(/)#/"#.&'*:#&-/0)%$#/"#123#4OKC#%/#6CC 7P-78#($#&.-/$%#()$%&)%&):/0$#&%# '//-# %:-?:'&%0':F # : $%&'()*&*'+,. (H(*.D(.#"<&D(KCC ("E(+18#.>8%"&(,"G<8%"&(8"(/+'%&(F%8*4((ADD+D(TC(8"(WC ("E(TU(,"D%<6(.>+8.8+( D+9+&D%&'("&(8*+(7"G<6+("E(8*+(,"G<8%"&( X (8.G>=# &%,#/'# A SC@:*H#"'::T:'#"/'#6C-()#/'#./)*:'9#=/0#;&)#?':;(?(%&%:#123#()# A SC@:*H#"'::T:'#/<:')(*,%#/'#()# A UC@:*H#"/'# &%#.:&$%#6K-()#/'#./)*:'F #

PAGE 90

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( 45(( 67%&(%&(8%1+9 : .&';+(<%=#"=+&>#%8?'+(.>( @ABCCC#7<(8"#(@D<%&(.>(#""<(>+<7 5 (E67%&&%&'(.>(A F G(9%9(&">(.88+=>( ( ( ( #+,?;>,H5((I.$+(,?#+(>*.>( !"" (>*+(>./,("8(>*+(>?/+J,(;%9,(7"%&>(?75(()*%,(K.L(+M+&(%8(L"?(=.&&">(,++(.(NOP(7+;;+>( ( L"? ($&"K(>*+(.77#"1%<.>+(7",%>%"&(%>(K%;;(/+(.&9(.M"%9(>*.>(.#+.(K*+&(7%7+>>%&'("88(+>*.&";5 ( ( ( A5(( P,7%#.>+ ("88((+>*.&";(,?7+#&.>.&>(K%>*(.(7%7+>>%&'(9+M%=+5((N#.K(;%Q?%9(8#"<(,%9+("8( ( ( (( >?/+("77",%>+("8(>*+(NOP(7+;;+>B(<"M%&'(8#"<(>*+(>"7(>"(9"K&5 ((ER"?(=.& (<.#$(>*+(,%9+("8(>?/+(K*+#+(7+;;+>(%,(( ( ((,>?=$H( ( ( ( ( D5((P99(@<;("8(2CS(+>*.&";(.>(#""<(>+<7+#.>?#+5((T&M+#>(>*+(>?/+(,+M+#.;(>%<+,(E<.$+(,?#+(NOP(%,(8;".>%&'(%&(%>H( ( (( .&9(,7%&(%&(=+&>#%8?'+(.,(%&(;.,>(,>+75 ( ( ( ( !"#$%&#'()*+,)*-#.*/01#23*+/2/454*6#53*# -'5))#789::.5-*-;#,-*#<=>#*4?50()#"(3#4?/-#-4*2@ # ( ( U5(( P,7%#.>+("88(>*+(,?7+#&.>.&>(.,(/+8"#+5((NOP(7+;;+>(9"+,(&">(,>%=$(K+;;(>"(>?/+((K*+&(?,%&'(2CS(+>*.&";(.>( ( ((#""<(>+<75((V+(=.#+8?;(.,7%#.>%&'5 ( ( ( 25(( P%#(9#%+9(>*+(7+;;+>("M+#&%'*>(.>(#""<(>+<7+#.>?#+ 5 ( ( ( W5((N%,,";M+(NOP(7+;;+>(%&( XD (@CYC5@()Z : /?88+# 5 ( ( ( 35((6>"#+(%&(8#++[+#(%8(?,%&'(;.>+#5 ( ( ( # # # # # # # # # # #

PAGE 91

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( !!!"##$%&'()&*+#,-. # ( -/01*0'23'(/04#/5#,-.#2*31'30'4 #306#6(&%'(/0#13&1%&3'(/04 7 # 45 6&7%8#"'+&(9:);( < (*.9(=33>-(?=3@A(+.B*C ( D 9%E>8+9(8"(F33>-(?G@A(+.B*C ( D H>8(=>-(?G@AC(%&(FG>-(HB#(#+B%H+(?35F@A(+.B*(9:);I(J%&.E(B"&B+&8#.8%"&C ( K5 6&7%8#"'+&("E%'"(H#%@+#,(?>,%&'(H#%@+#(=LL0(?J"#M.#9(,+N>+&B+C (J"#(+1.@HE+C ( D +.B*("E%'"(B.@+(.8(9%JJ+#+&8(N>.8%8%+,(J#"@(O=5PF( < (QG5=2&A ( D "E%'"(=LL0(B.@+(.8(OF5QQ&A ( D ,>,H+&9+9(%&(35G@-()R (/>JJ+#(?=3@AS35=@AC ( OF5QQ&@"E+,T35G@-(U(=>@"E+,T=333&@"E+,(U(=333@-T-(V(LQ522(>A ( 6J(6(M.&8(G>A(%&(FG3>-("J(,"E>8%"&(>,%&'(LQ522>AS ( ?G>AC?FG3>-C(V(?LQ522>AC1I((1(V(?G>ATLQ522>AC?FG3>-C(V(=W5FLL>( D @%1+9(=W5FLL>-("J(=LL0("E%'"(.8(LQ522>A(M%8*(FO35PO2>-(:.&"H >#+(M.8+# ( D H>8(=>-("J(+.B*("E%'"(?G>AC(%&(FG>-("J(HB#(#+B%H+(?35F>A(J%&.E(B"&B+&8#.8%"&C ( ( X5 6&7%8#"'+&(;E.8%&>@().N;"E ( D *.9(G3>-("J(GYT>-(?B"&8.%&,(FG3(#+.B8%"&,(J"#(G3>-(HB#(#+.B8%"&,I(.,(.97+#8%,+9(/Z(6&7%8#"'+&C ( D .99+9(F33>-(&.&"H>#+(M.8+#I(&"M(%8,(=YT>E ( D H>8 (=>-(%&(FG>-("J(HB#(#+B%H+(?353QYT>-(J%&.E(B"&B+&8#.8%"&C ( ( 6(9+B%9+9(8"(@.$+(F(@>E8%HE+1(#+.B8%"&,(/+B.>,+(8*+(+1H+B8+9(E+&'8*,("J(.@HE%B"&,(J#"@(K.>@,(+8(.E5(?F33GC("J(H#%@+#,( =LL(.&9(=2F(.&9(F3P(.&9(=WF(M.,("&EZ(.(9%JJ+#+&B+("J(O/H(/+8M++&(/"8*(H.%#, (?). /E+(=C 5((6J(6(9%9(&"8(,+H.#.8+(8*+@(8*+( [:4(/.&9,(%&(+E+B8#"H*"#+,%,(,8+H(M">E9(/+(.@/%'>">,(J"#(+%8*+#(H#%@+#(.&9(6(M">E9(&"8(/+(./E+(8"(9%JJ+#+&8%.8+(8*+(Q( E"B%5 (

PAGE 92

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( !"#$%&'( (4#%5+#(,+67+&8+,9(57:;%<:+1(=+,%'&.;%"&9(+1<+8;+=(.5<:%8"&(:+&';*(.&=(&75/+#(">(??) (#+<+.;,(@;*%,(%,(.(8"( )./:+(B("&(<.'+(BC(>#"5(5.%&(;*+,%,(/"=AD ( Expected Amplicon Number of Primer Direction Sequence Multiplex Length (bp) AAT repeats 166 Forward TCTACCCGCAATTTTCATCA I 168 28 Reverse CGCTCTCCCTATGTTCGATTG 181 Forward TTCTCCACATGCAAACAAACA I 152 10 Reverse GCCAGGATAGCGGATAATGA 207 Forward ATCCACGCCCAAACAATGTA I 183 20 Reverse CTATTCGCTACCCACGCTTC 182 Forward TCCCACAACTCACACTCTGC II 165 18 Reverse ACGCGGAAATAGTGATGCTC 192 Forward TTTGAGCATTTAAGGAGCAACA II 180 28 Reverse CAGCAGACTCAACAGCAGGA &

PAGE 93

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( !"#$%&' ( (4567%86+1(9(.&:(99(#+;%8+,(<"#(=(#+.;7%"&(.&:(<"#(>.,7+#(>%1(<"#(3?(#+.;7%"&,@ ( ( ( MULT I 1 reaction final conc Master Mix MULT II 1 reaction final conc. Master Mix 166F 1uL 0.2uM 20ul 182F 1uL 0.2uM 20uL 166R 1uL 0.2uM 20uL 182R 1uL 0.2uM 20uL 181F 1uL 0.2uM 20uL 192F 1uL 0.2uM 20uL 181R 1uL 0.2uM 20uL 192R 1uL 0.2uM 20uL 207F 1uL 0.2uM 20uL MgCl2 1uL 2mM 20uL 207R 1uL 0.2uM 20uL PCR Buff 10x 2.5uL 1X 50uL MgCl2 1uL (50mM) 2mM 20uL dNTPs 1uL 0.2mM each 20uL PCR Buff 10X 2.5uL 1X 50uL H2O 10.5uL 210uL dNTPs 1uL 0.2mM each 20uL subTOTAL 19uL 380uL H2O 8.5uL 170uL TaqPol 1uL 0.04U/uL 20uL subTOTAL 19uL 380uL DNA template 5uL TaqPol 1uL 0.04U/uL 20uL Final Volume 25uL DNA template 5uL Final volume 25uL

PAGE 94

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( ( ( 45 -./+6(7589-(:+&;#%<='+(;=/+,(>%;*(:.?,5 (0"#(+1.9?6+@ ( ( A4B4( C (:"6"&D(4E(9=6;%?6+1(F ( A4B8( C (:"6"&D(4E( 9=6;%?6+1(FF ( G&++H(8(;=/+,(?+#(:"6"&D(<"#(;*+(8(9=6;%?6+1(#+.:;%"&,I ( ( 85 )*.>("=;(JKL(,"6=;%"&,("<(87(:"6"&%+,(( ( 35 0"#(;*%,(,;=HD(F(.6,"(6+<;("=;(;*+(HK)M,(<#"9(;*+(9.,;+#(9%1 (G)./6+(8I 5 ( N5 M%?+;;+(42 ("<(9.,;+#(9%1(9=6;%?6+1(F(%&;"(.66(;=/+,(>%;*(6./+6(AOB4E(.&H (9.,;+#(9%1(9=6;%?6+1(FF(%&;"(.66(;=/+,(>%;*( 6./+6(AOB85 ( P5 M%?+;;+(4 (HK)M (%&;"(.66(MAQ(;=/+,( !"# ("&("&+(,%H+("< (;=/+(./"R+(;*+(9.,;+#(9%1(,"6=;%"&(GJ"(&";(;#D(;"(9%1(%&(>%;*( ,"6=;%"&(.;(;*+(/";;"95(()*% ,(%,(;"(?#+R+&;(.#;%<.:;=.6( #+.:;%"&,(/+<"#+(MAQ(,;+?5 ((L-STE(%;(.66">,(D"=(;"(H%<<+#+&;%.;+( /+;>++&(;=/+,(;*.;(.6#+.HD(*.R+(;*+(HK)M,("#(&";(%&(:.,+(D"=(6",+(;#.:$5((F(.6,"(,=''+,;(6%&%&'(;*+(;=/+,(%&('#"=?,("<(P( .&H(:"=&;(4(;"(P(>%;*(+R+#D(.HH%;%"&(;"(*+6?($++?(;#.:$("<(>*%:*(;=/+(D"=(.#+(.; (H=#%&'(.HH%;%"& ("<(HK)M, I 5 ( U5 M%?+;;+(4 ().VM"6(,"6=;%"&("&(.&";*+#(,%H+("<(;*+(MAQ(;=/+E(W=,;(6%$+(;*+(HK)M5 ( X5 M%?+;;+(P ("<(JKL(;+9?6.;+(%&;"(.&";*+#(.#+.("&(;*+(,%H+("<(;*+(;=/+(.&H(:6",+(6%H("<(;=/+(G;*%,(;+66,(D"=(>*%:*(;=/+,( .6#+.HD(*.R+(;*+(JKL(;+9?6.;+I5 ( 25 )=#&("&(MAQ (9.:*%&+(;"(,%;(.;(YP Z A(G.(?#+ [ ,+;(9+;*"H(?#"'#.9I5( ( Y5 A+&;#%<='+(MAQ(;=/+,(,"(;*.;(HK)M,E().VM"6E(.&H(JKL(;+9?6.;+(,6%H+(;">.#H,(.&H(9%1(.;(;*+(/";;"9("<(;*+(;=/+(GP,+:( V=%:$(,?%&I5(( $%&"%' (=,+(;*+(*%'*(,?++H(:+&;#%<='+E(%;(%,(;""(?">+#<=6(.&H(/#+.$,\:#.:$, (;*+(;*%& [ >.66+H(?6.,;%:(MAQ( ;=/+,5 ( 475 )=#&("<<(;*+(YP Z A( ?#"'#.9("&(;*+(MAQ(9.:*%&+(.&H(6".H(,.9?6+,(%&(;*+(>+66,5 ( 445 S;.#;( B+;*"H(PY("&(MAQ(9.:*%&+(<"#(9=6;%?6+1(#+.:;%"&(G ,++( )./6+(3I ( ( ( ( ( (

PAGE 95

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( !"#$%&'( (4+5*"6(&78/+#,(.&6(9#"'#.8(6+,:#%95%"&(7,+6(;"#(<=>(8.:*%&+(?;"#(.(@A (#+.:5%"&(B"C78+D(E,+#(&78/+#F(GHI ( ( 4J)KLM( ( ( (&78/+# ( 4+5*"6(6+,:#%95%"& ( ( (((((AH ( ( GA N =(;"#(A8%&75+, ( (((((AO ( ( 3 N =(;"#+B+# ( ((((( AA ( ( P@ N =(;"#(A8%&75+, ( ((((( A2 ( ( 3Q(:R:C+,(";(SGA N =(;"#(@Q,+ :"&6,( T (AQ N =(;"#(@Q,+:"&6,( T (P@ N =(;"#(OQ(,+:"&6,U ( ((((( AG ( ( ="8/%&+,(5*+(8+5*"6,(%&(5*%,("#6+#F(AH T A2 T AA T AO ( ( ( H@V W;5+#(<=>(#+.:5%"&X(#+8"B+(,.89C+,(.&6(;#++Y+(;"#(;757#+(7,+V ( & & & & & & & & & & & & & & & & &

PAGE 96

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( !"#$%&'()*+$&+,$+,+-.()/0)(+*1* $ $ $ Name Formula M Mass (g) melt (C) boil (C) HAZARDS Boric acid H3BO3 61.83 170.9 300 May impair fertility and cause harm to unborn child NaOH 39.99711 318 1388 CAUSES BURNS $ %# 2344+(*5$*),3.1)6*5$'67$8'*.+($91:+* $ $ %#;#$ 4#+5.#+(36678(96: $ ;"<%=7(/"#%>(.>%<(?;@A(/=BB+# ( ( CD E%,,"8F+(G'(H.IJ (%&(.55#"1%7.K+8L(G667-(<%,K%88+<(M.K+#(%&(.(C-(/+.$+#D ( 9D 48.>+(/+.$+#("&(,K%##+#(M%K*(.(7.'&+K%>(,K%##+#N(K=#&("&(,K%##+#(K"(8"M(,+KK%&'("B(9D ( OD P<<(/"#%>(.>%<(=&K%8(5J(Q(2D6(?.#"=&<(9O'AD((R.$+(,=#+(&"(>#L,K.8,(.#+(5#+,+&K(M*+&(>*+>$%&'(K*+(5JD ( GD )#.&,B+#(K"(. ('#.<=.K+<(>L>8%&<+#(.&<(.<<(<%,K%88+<(M.K+#(=5(K"(3667-D ( 3D )#.&,B+#(K"(,K"#.'+(>"&K.%&+#(M%K*(>.5S8%< (.&<(5#"5+#8L(8./ +8D ( ( PD9D(4#+5.#+(96/5(8.<<+#(,"8=K%"&(B"#(+8+>K#"5*"#+,%, ( ( CD R%1(CO (8".<%&'(*N(G6UVAN(.&<(93 (H .&"5=#+(M.K+#D ( 9D U,+(C9 ("B(K*%,(,"8=K%"&(5+#(M+88D ( ( PDOD(4#+5.#+(W667-(C:(;@ T /=BB+# ( ( CD R+.,=#+("=K(O67-("B(96:(;@ T /=BB+#N(K#.&,B+#(K"(.(C6667-('#.<=.K+<(>L8%&<+# ( 9D P<<(<%,K%88+<(M.K+#(K"(W667( $

PAGE 97

!"#$%&'()*+,%,(-./ ( 0+&%1 ( ( ( ( ( 23 ( !" #$%&'()*$)+*)+),-&'./'&)(0(*(-).( 45 67.8+(459'(":(.'.#",+ (%&(.(;<<=-(:7.,$ ( ;5 >??(2@=-(":(4A(BC D /E::+# (FG*%,(=.$+,(.(;H('+7I ( J5 K%8#"L.M+( G"(?%,,"7M+(.'.#",+(%&(/E::+#5(( ( C+(8.#+:E7(&"G(G"(7+G(G*+(,"7EG%"&(/"%7("M+#5((N(,G.#G+?(4=%&(.G(O"L+#(7+M+7(477"L(G"(8""7(,7%'*G7R(.&?(.??(25@ (T+7(#+?(G"(.'.#",+(,"7EG%"&(.&?(O"E#(%&G"('+7(G+=O7.G+(L%G*(8"=/5 ( @5 !*+&('+7(*.?(,"7%?%:%+?(.&?(#+.8*+?(#""=(G+=O+#.GE#+P(#+="M+('+7(G+=O7.G+P(#+="M+(8"=/P(.&?(O7.8+(/.8$(%&(/"1(L%G*( G*+(L+77,("&(G*+(&+'.G%M+(&"?+U,(,%? +5(( )*+(L+77,(L+#+("&(G*+(7+:G(,%?+(.&?(VW>(G#.M+7+?(G"(G*+(#%'*G(G"L.#?,(G*+(O",%G%M+( &"?+5 ( 35 0%77(G*+(/"1(L%G*(#+=.%&%&'(@4@=-(":(4A(BC D /E::+#5((F)*+('+7(%,(8"M+#+?(L%G*(BC D /E::+#(.OO#"1%=.G+7R(X(":(%G,( G*%8$&+,,I ( 95 6",%G%"&('+7(/"1(L*+#+(%G(L%77(,%G(:"#(+7+ 8G#"O*"#+,%,5(FYZ[(\>WWZ)(KZ]^(CZA(>0)^_(0N--NWT()`^(!^--BI(67.8+(.( O%+8+(":(=.,$%&'(G.O+(.7"&'(G*+(7+&'G*(":(G*+(/"1(G"(#+8"#?(7".?%&'(?R+(="M+=+&G5 (( ( 25 )*+#+(L+#+(43(L+77,5((N(7".?+?(G*+(L+77,(%&(G*%,("#?+#(:#"=(G"O(G"(/"GG"=a(4; (;(G+=O7.G+(:#"=(=E7G%O7+1(N(#+.8G%"&,(F%+5(6\_(#+.8G%"&,(\4K4(G"(\3K4I(E,%&'(4; (":(VW>(G+=O7.G+(.&?( ;5@ (7".?%&'(?R+(=%1+?(L%G*(G*+(VW>(G+=O7.G+P(;5@ (4$/O(7.??+#P(4; (;(G+=O7.G+(.&?(;5@ (7".?%&'(?R+P( .&?(;5@ (4$/O(7.??+#5 ( b5 \"M+#+?(G*+(/"1P(.GG.8*+?(O"L+#(,EOO7R(.&?(,+G(G"(4S<](.&?(#.&('+7(.OO#"1%=.G+7R(:"#(;*"E#,5((N($+OG(G#.8$(":(*"L(:.,G( G*+(7".?(?R +(="M+?(/R(=.#$%&'(G*+(=.,$%&'(G.O+("&(G*+(G./7+(G"O(/+,%?+(G*+('+7(/"1(.&?(&"G%&'(G*+(G%=+5((N(GE#&+?(":(G*+( O"L+#(,EOO7R(L*+&(G*+(7+.?(?R+(L.,(./"EG(48=(:#"=(G*+(+?'+P(,"=+G%=+,(G*+(7+.?(?R+(L.,(&"G(M%,%/7+P(/EG(G*+(; &? (/.8$( ?R+(L.,(,G%77(M%,%/7(.&?(L.,( .OO#"1%=.G+7R(;c@G*,(?"L&(G*+('+75 ( 4<5 N==+?%.G+7R(M%,E.7%d+(.&?(O*"G"'#.O*(E,%&'( C%"N=.'+ (N&G+77%'+&G(eE.&G%:%+#5 ( ( (

PAGE 98

! "" !""#$%&'()))*(+,"-(,.(/0#(/#'/(,.(/0#(+1-,2(+,30&$,2(!430&"#516,(71/8415( 914&$#(9,$8:#$/(;1<(=&$(>"1$&20?@ ( #$%$&$'($) *+',-&./!0+&.1!#$$%!2-',!3*0#24!56'7$&'$789!5-:,.7$,!;<<=!>.&!??89!@.!0A$B.C! *+',-&./)!#$.,A'D!1A/7 E!5(A7$,!;.&!F89!GH.A1.B1$!%&+I! J77:)KKLLL9(.M+/(+(JA'+/9+&DK:,%K0.M+/N0+(JA'+/N@$MNG9:,%

PAGE 99

! "# !""#$%&'())(*+"",#-#$./ (0+1"2*#(23(4%%&.&2$4,(56 7 8+33#1(94*:(*.#"(8#321#( #'.14;.&2$< ( ( $%&'!%(!)*'!%+,-./0!&-))'+!/.!1%&'!%(!)*'!1-&23'1!4%536!.%)!2'33')!'7'.! -()'+!-66 /)/%.-3!0'.)+/(5,-)/%.!-.6!-)!0%%3'+!)'&2'+-)5+'1!89!-.6!:96',+''1;'-+1!%36;!)*-)!/)!*-6!-3&%1)!)*'!1-&'!6'.1/)>!%(!)*'!1%35)/%.1)-31!4/)*!)*'!-66/)/%.!%(!')*-.%3! 8'/)*'+!#A E @AAL;!%+!)*'!1-&23'1!*-6!0+>1)-31!-3+'-6>!2+'1'.)1)-3!(%+&-)/%.!-)!)*'!')*-.%3! 2+'0/2/)-)/%.!1)'2!51/.,!1%35)/%.1!(+%&!2+'7/%51!1)'21< 6.:4$2, M!2*'.%3!1%3N. !!!!!!!M!OP!1%6/5&!-0')-)'!!!!!M!2+'1'+7/.,!1%35)/%. ! >1?*.4,( ( 321-4.&2$ !!!!!!!!!!K%! !!!!!!!!!K% Q'1 @A#*(21(B2C ( (

PAGE 100

! "" !""#$%&'()))*(+,"-(,.(/0#(/#'/(,.(/0#(+1-,2(+,30&$,2(!430&"#516,(71/8415( 914&$#(9,$8:#$/(;1<(=&$(>"1$&20?@ ( #$%$&$'($) *+',-&./!0+&.1!#$$%!2-',!3*0#24!56'7$&'$789!5-:,.7$,!;<<=!>.&!??89!@.!0A$B.C! *+',-&./)!#$.,A'D!1A/7 E!5(A7$,!;.&!F89!GH.A1.B1$!%&+I! J77:)KKLLL9(.M+/(+(JA'+/9+&DK:,%K0.M+/N0+(JA'+/N@$MNG9:,%

PAGE 105

! "# !""#$%&'()*+(,-".(-/(01#(0#'0(-/(01#(2#34560&-$7(-/(01#(,6.-7(,-81&$-7( !281&"#563-(9604265(:62&$#(:-$4;#$0(<6=(>)$(?"6$&71@A ( $%&%'%()%* +,(-.'/0!1,'/2!$%%&!3.(-!4+1$ 35!67(8%'(%89:!6.;-/8%-!<==>!?/(!<=9:!@/!1A%B/C! +,(-.'/0*!$%/-A(D!2A08E!6)A8%-!<=FF!G/'!H9:!IJ/A2/B2%!&',K! L88;*MMNNN:)/O,0),)LA(,0:,'DM;-&M$%D2/K%(8,P2%OP1/O,0P1, )LA(,0PQ<=),K;2%8, :;-&

PAGE 114

! "#$ !""#$%&'()*(!+,-./#(0#1/ ( %&'!()*+,-./!0)1!203121+4!&5-*2*67!6,831)9:58,2.;(21!!?*)! 1<08(21@!&":"!8106/!-*2*67!" A 8,2.;(21!!BC1!DEF!20++1)/!G*)!H;/,02;I;6J!.C1!J12 / K1)1!"L3(!06+!$#3(> 2&+3-#(4 !M12 !2061/!G)*8!21G.!.*!);JC.4!$#3(!20++1)@!&":"@!&$:"@!&N:"@!&O:"@!&P:"@!&Q:"@!"L3(! 20++1)@!$#3(!20++1)@!&":$@!&$:$@!&N:$@!&O:$@!&P:$@!&Q:$@!06+!"L3(!20++1)> !!5BC1!$##3(!306+!*G! .C1!20++1)!;/!16-;)-21+9>

PAGE 115

! "#$ !"#$%&'() !%&'!'()&*!+,-.!'&+/!/-!,012/3 !"456!'(77&,8!9":;:8!9"";:8!9"#;:8!9<;:8!9=;:8!9>;:8!:#56! '(77&,8!"456!'(77&,8!9":;"8!9"";"8!9"#;"8!9<;"8!9=;"8!9>;"8!:#56!'(77&,?!!@A2&!:##56!5()7!-+! /2&!'(77&,!0*!&)B0,B'&7C?

PAGE 116

! "#$ !"#$%&'() !%&'!'()&*!+,-.!'&+/!/-!,012/3!"456!'(77&,8!9:#;:8!9"<;:8!9"=;:8!9 :#;"8!9"<;"8!9"=;"8! :#56!'(77&,8!"456!'(77&,8!9">;:8!9"$;:8!9"?;:8!9">;"8!9"$;"8!9"?;"8!:#56!'(77&,@!AB2&!:##56! 5()7!-+!/2&!'(77&,!0*!&)C0,C'&7D@

PAGE 117

! "#$ !"#$%&'() !%&'!'()&*!+,-.!'&+/!/-!,012/3!"456!'(77&,8!9:#;<8!9<=;<8!9<>;<8!9;"8!9
PAGE 118

! "#$ "#$%&'!() !%&'!'()&*!+,-.!'&+/!/-!,012/3!"456!'(77&,8!9:$;:8!9:<;:8!9:=;:8!9:>;:8!9::;:8!9:";:8! "456!'(77&,8!9:$;"8!9:<;"8!9:=;"8!9:>;"8!9::;"8!9:";"8!:#56!'(77&,?!@A2&!:##56!5()7!-+!/2&! '(77&,!0*!&)B0,B'&7C?

PAGE 119

! "#$ !"#$%&'() !%&'!'()&*!+,-.!'&+/!/-!,012/3!"456!'(77&,8!9 :;<=8!9:><=8!9:?<=8!9::<=8!9:=<=8!9:"<=8! =#56!'(77&,8!"456!'(77&,8!9:;<"8!9:><"8!9:?<"8!9::<"8!9:=<"8!9:"<"8!=#56'(77&,@!AB2&!=##56! 5()7!-+!/2&!'(77&,!0*!&)C0,C'&7D@

PAGE 120

! "#$ !"#$%&'() !%&'!'()&*!+,-.!'&+/!/-!,012/3!"456!'(77&,8!9:;<=8!9::<=8!9:#<=8!9>?<=8!9>$<= 8!9>@<=8! =#56!'(77&,8!"456!'(77&,8!9:;<"8!9::<"8!9:#<"8!9>?<"8!9>$<"8!9>@<"8!=#56!'(77&,A!BC2&!=##56! 5()7!-+!/2&!'(77&,!0*!&)D0,D'&7EA


ERROR LOADING HTML FROM SOURCE (http://ncf.sobek.ufl.edu//design/skins/UFDC/html/footer_item.html)